Back to Multiple platform build/check report for BioC 3.17 |
|
This page was generated on 2023-01-28 11:09:58 -0500 (Sat, 28 Jan 2023).
Hostname | OS | Arch (*) | R version | Installed pkgs |
---|---|---|---|---|
nebbiolo1 | Linux (Ubuntu 22.04.1 LTS) | x86_64 | R Under development (unstable) (2023-01-10 r83596) -- "Unsuffered Consequences" | 4465 |
palomino3 | Windows Server 2022 Datacenter | x64 | R Under development (unstable) (2023-01-10 r83596 ucrt) -- "Unsuffered Consequences" | 4246 |
merida1 | macOS 10.14.6 Mojave | x86_64 | R Under development (unstable) (2023-01-10 r83596) -- "Unsuffered Consequences" | 4269 |
Click on any hostname to see more info about the system (e.g. compilers) (*) as reported by 'uname -p', except on Windows and Mac OS X |
To the developers/maintainers of the StructuralVariantAnnotation package: - Please allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/StructuralVariantAnnotation.git to reflect on this report. See How and When does the builder pull? When will my changes propagate? for more information. - Make sure to use the following settings in order to reproduce any error or warning you see on this page. |
Package 1972/2162 | Hostname | OS / Arch | INSTALL | BUILD | CHECK | BUILD BIN | ||||||||
StructuralVariantAnnotation 1.15.0 (landing page) Daniel Cameron
| nebbiolo1 | Linux (Ubuntu 22.04.1 LTS) / x86_64 | OK | OK | ERROR | |||||||||
palomino3 | Windows Server 2022 Datacenter / x64 | OK | OK | ERROR | NA | |||||||||
merida1 | macOS 10.14.6 Mojave / x86_64 | OK | OK | ERROR | OK | |||||||||
Package: StructuralVariantAnnotation |
Version: 1.15.0 |
Command: /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:StructuralVariantAnnotation.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings StructuralVariantAnnotation_1.15.0.tar.gz |
StartedAt: 2023-01-28 07:19:52 -0500 (Sat, 28 Jan 2023) |
EndedAt: 2023-01-28 07:33:24 -0500 (Sat, 28 Jan 2023) |
EllapsedTime: 812.4 seconds |
RetCode: 1 |
Status: ERROR |
CheckDir: StructuralVariantAnnotation.Rcheck |
Warnings: NA |
############################################################################## ############################################################################## ### ### Running command: ### ### /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:StructuralVariantAnnotation.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings StructuralVariantAnnotation_1.15.0.tar.gz ### ############################################################################## ############################################################################## * using log directory ‘/Users/biocbuild/bbs-3.17-bioc/meat/StructuralVariantAnnotation.Rcheck’ * using R Under development (unstable) (2023-01-10 r83596) * using platform: x86_64-apple-darwin17.0 (64-bit) * R was compiled by Apple clang version 12.0.0 (clang-1200.0.32.29) GNU Fortran (GCC) 8.2.0 * running under: macOS Mojave 10.14.6 * using session charset: UTF-8 * using option ‘--no-vignettes’ * checking for file ‘StructuralVariantAnnotation/DESCRIPTION’ ... OK * checking extension type ... Package * this is package ‘StructuralVariantAnnotation’ version ‘1.15.0’ * package encoding: UTF-8 * checking package namespace information ... OK * checking package dependencies ... OK * checking if this is a source package ... OK * checking if there is a namespace ... OK * checking for hidden files and directories ... OK * checking for portable file names ... OK * checking for sufficient/correct file permissions ... OK * checking whether package ‘StructuralVariantAnnotation’ can be installed ... OK * checking installed package size ... OK * checking package directory ... OK * checking ‘build’ directory ... OK * checking DESCRIPTION meta-information ... OK * checking top-level files ... OK * checking for left-over files ... OK * checking index information ... OK * checking package subdirectories ... OK * checking R files for non-ASCII characters ... OK * checking R files for syntax errors ... OK * checking whether the package can be loaded ... OK * checking whether the package can be loaded with stated dependencies ... OK * checking whether the package can be unloaded cleanly ... OK * checking whether the namespace can be loaded with stated dependencies ... OK * checking whether the namespace can be unloaded cleanly ... OK * checking dependencies in R code ... OK * checking S3 generic/method consistency ... OK * checking replacement functions ... OK * checking foreign function calls ... OK * checking R code for possible problems ... OK * checking Rd files ... OK * checking Rd metadata ... OK * checking Rd cross-references ... OK * checking for missing documentation entries ... OK * checking for code/documentation mismatches ... OK * checking Rd \usage sections ... OK * checking Rd contents ... OK * checking for unstated dependencies in examples ... OK * checking files in ‘vignettes’ ... OK * checking examples ... OK Examples with CPU (user + system) or elapsed time > 5s user system elapsed findBreakpointOverlaps 7.273 0.048 9.776 breakpointRanges 5.895 0.212 8.156 breakendRanges 5.836 0.116 7.794 countBreakpointOverlaps 5.012 0.031 6.540 numtDetect 4.008 0.018 5.177 * checking for unstated dependencies in ‘tests’ ... OK * checking tests ... Running ‘testthat.R’ ERROR Running the tests in ‘tests/testthat.R’ failed. Last 13 lines of output: 13. │ ├─BiocGenerics (local) standardGeneric("Map") 14. │ │ ├─BiocGenerics::eval(mc, env) 15. │ │ └─base::eval(mc, env) 16. │ │ └─base::eval(mc, env) 17. │ └─base::Map(f = f, ...) 18. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 19. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 20. │ ├─Rsamtools::scanBcfHeader(bf) 21. │ └─Rsamtools::scanBcfHeader(bf) 22. └─base::.handleSimpleError(...) 23. └─base (local) h(simpleError(msg, call)) [ FAIL 45 | WARN 27 | SKIP 0 | PASS 105 ] Error: Test failures Execution halted * checking for unstated dependencies in vignettes ... OK * checking package vignettes in ‘inst/doc’ ... OK * checking running R code from vignettes ... SKIPPED * checking re-building of vignette outputs ... SKIPPED * checking PDF version of manual ... OK * DONE Status: 1 ERROR See ‘/Users/biocbuild/bbs-3.17-bioc/meat/StructuralVariantAnnotation.Rcheck/00check.log’ for details.
StructuralVariantAnnotation.Rcheck/00install.out
############################################################################## ############################################################################## ### ### Running command: ### ### /Library/Frameworks/R.framework/Resources/bin/R CMD INSTALL StructuralVariantAnnotation ### ############################################################################## ############################################################################## * installing to library ‘/Library/Frameworks/R.framework/Versions/4.3/Resources/library’ * installing *source* package ‘StructuralVariantAnnotation’ ... ** using staged installation ** R ** inst ** byte-compile and prepare package for lazy loading ** help *** installing help indices ** building package indices ** installing vignettes ** testing if installed package can be loaded from temporary location ** testing if installed package can be loaded from final location ** testing if installed package keeps a record of temporary installation path * DONE (StructuralVariantAnnotation)
StructuralVariantAnnotation.Rcheck/tests/testthat.Rout.fail
R Under development (unstable) (2023-01-10 r83596) -- "Unsuffered Consequences" Copyright (C) 2023 The R Foundation for Statistical Computing Platform: x86_64-apple-darwin17.0 (64-bit) R is free software and comes with ABSOLUTELY NO WARRANTY. You are welcome to redistribute it under certain conditions. Type 'license()' or 'licence()' for distribution details. R is a collaborative project with many contributors. Type 'contributors()' for more information and 'citation()' on how to cite R or R packages in publications. Type 'demo()' for some demos, 'help()' for on-line help, or 'help.start()' for an HTML browser interface to help. Type 'q()' to quit R. > library(testthat) > library(StructuralVariantAnnotation) Loading required package: GenomicRanges Loading required package: stats4 Loading required package: BiocGenerics Attaching package: 'BiocGenerics' The following objects are masked from 'package:stats': IQR, mad, sd, var, xtabs The following objects are masked from 'package:base': Filter, Find, Map, Position, Reduce, anyDuplicated, aperm, append, as.data.frame, basename, cbind, colnames, dirname, do.call, duplicated, eval, evalq, get, grep, grepl, intersect, is.unsorted, lapply, mapply, match, mget, order, paste, pmax, pmax.int, pmin, pmin.int, rank, rbind, rownames, sapply, setdiff, sort, table, tapply, union, unique, unsplit, which.max, which.min Loading required package: S4Vectors Attaching package: 'S4Vectors' The following objects are masked from 'package:base': I, expand.grid, unname Loading required package: IRanges Loading required package: GenomeInfoDb Loading required package: rtracklayer Loading required package: VariantAnnotation Loading required package: MatrixGenerics Loading required package: matrixStats Attaching package: 'MatrixGenerics' The following objects are masked from 'package:matrixStats': colAlls, colAnyNAs, colAnys, colAvgsPerRowSet, colCollapse, colCounts, colCummaxs, colCummins, colCumprods, colCumsums, colDiffs, colIQRDiffs, colIQRs, colLogSumExps, colMadDiffs, colMads, colMaxs, colMeans2, colMedians, colMins, colOrderStats, colProds, colQuantiles, colRanges, colRanks, colSdDiffs, colSds, colSums2, colTabulates, colVarDiffs, colVars, colWeightedMads, colWeightedMeans, colWeightedMedians, colWeightedSds, colWeightedVars, rowAlls, rowAnyNAs, rowAnys, rowAvgsPerColSet, rowCollapse, rowCounts, rowCummaxs, rowCummins, rowCumprods, rowCumsums, rowDiffs, rowIQRDiffs, rowIQRs, rowLogSumExps, rowMadDiffs, rowMads, rowMaxs, rowMeans2, rowMedians, rowMins, rowOrderStats, rowProds, rowQuantiles, rowRanges, rowRanks, rowSdDiffs, rowSds, rowSums2, rowTabulates, rowVarDiffs, rowVars, rowWeightedMads, rowWeightedMeans, rowWeightedMedians, rowWeightedSds, rowWeightedVars Loading required package: SummarizedExperiment Loading required package: Biobase Welcome to Bioconductor Vignettes contain introductory material; view with 'browseVignettes()'. To cite Bioconductor, see 'citation("Biobase")', and for packages 'citation("pkgname")'. Attaching package: 'Biobase' The following object is masked from 'package:MatrixGenerics': rowMedians The following objects are masked from 'package:matrixStats': anyMissing, rowMedians Loading required package: Rsamtools Loading required package: Biostrings Loading required package: XVector Attaching package: 'Biostrings' The following object is masked from 'package:base': strsplit Attaching package: 'VariantAnnotation' The following object is masked from 'package:base': tabulate > > test_check("StructuralVariantAnnotation") [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [W::bcf_hdr_check_sanity] PL should be declared as Number=G [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [E::bcf_hdr_parse_sample_line] Could not parse the "#CHROM.." line, either FORMAT is missing or spaces are present instead of tabs: #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT [ FAIL 45 | WARN 27 | SKIP 0 | PASS 105 ] ══ Failed tests ════════════════════════════════════════════════════════════════ ── Error ('test-BreakpointGRanges.R:27'): .constrict ─────────────────────────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'start': error in evaluating the argument 'x' in selecting a method for function 'start': error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─testthat::expect_equal(...) at test-BreakpointGRanges.R:27:8 2. │ └─testthat::quasi_label(enquo(object), label, arg = "object") 3. │ └─rlang::eval_bare(expr, quo_get_env(quo)) 4. ├─stats::start(...) 5. ├─StructuralVariantAnnotation:::.constrict(...) 6. │ └─stats::start(gr) 7. ├─StructuralVariantAnnotation::breakpointRanges(...) 8. ├─StructuralVariantAnnotation:::.testrecord(...) 9. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 10. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 11. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 12. │ └─VariantAnnotation:::.readVcf(...) 13. │ └─VariantAnnotation:::.scanVcfToVCF(...) 14. │ ├─VariantAnnotation::scanVcfHeader(file) 15. │ └─VariantAnnotation::scanVcfHeader(file) 16. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 17. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 18. │ └─BiocGenerics::Map(...) 19. │ ├─BiocGenerics (local) standardGeneric("Map") 20. │ │ ├─BiocGenerics::eval(mc, env) 21. │ │ └─base::eval(mc, env) 22. │ │ └─base::eval(mc, env) 23. │ └─base::Map(f = f, ...) 24. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 25. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 26. │ ├─Rsamtools::scanBcfHeader(bf) 27. │ └─Rsamtools::scanBcfHeader(bf) 28. ├─base::.handleSimpleError(...) 29. │ └─base (local) h(simpleError(msg, call)) 30. ├─base::.handleSimpleError(...) 31. │ └─base (local) h(simpleError(msg, call)) 32. └─base::.handleSimpleError(...) 33. └─base (local) h(simpleError(msg, call)) ── Error ('test-BreakpointGRanges.R:41'): findBreakpointOverlaps ─────────────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'as.data.frame': error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─testthat::expect_equal(...) at test-BreakpointGRanges.R:41:8 2. │ └─testthat::quasi_label(enquo(object), label, arg = "object") 3. │ └─rlang::eval_bare(expr, quo_get_env(quo)) 4. ├─BiocGenerics::as.data.frame(...) 5. ├─StructuralVariantAnnotation::findBreakpointOverlaps(...) 6. │ └─StructuralVariantAnnotation:::.assertValidBreakpointGRanges(query) 7. ├─StructuralVariantAnnotation::breakpointRanges(...) 8. ├─StructuralVariantAnnotation:::.testrecord(...) 9. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 10. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 11. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 12. │ └─VariantAnnotation:::.readVcf(...) 13. │ └─VariantAnnotation:::.scanVcfToVCF(...) 14. │ ├─VariantAnnotation::scanVcfHeader(file) 15. │ └─VariantAnnotation::scanVcfHeader(file) 16. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 17. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 18. │ └─BiocGenerics::Map(...) 19. │ ├─BiocGenerics (local) standardGeneric("Map") 20. │ │ ├─BiocGenerics::eval(mc, env) 21. │ │ └─base::eval(mc, env) 22. │ │ └─base::eval(mc, env) 23. │ └─base::Map(f = f, ...) 24. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 25. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 26. │ ├─Rsamtools::scanBcfHeader(bf) 27. │ └─Rsamtools::scanBcfHeader(bf) 28. ├─base::.handleSimpleError(...) 29. │ └─base (local) h(simpleError(msg, call)) 30. └─base::.handleSimpleError(...) 31. └─base (local) h(simpleError(msg, call)) ── Error ('test-BreakpointGRanges.R:93'): findBreakpointOverlaps: delly vs truth ── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─StructuralVariantAnnotation::breakpointRanges(.testrecord(c("chr12\t6905246\tDEL00000292\tN\t<DEL>\t.\tPASS\tPRECISE;CIEND=-52,52;CIPOS=-52,52;SVTYPE=DEL;SVMETHOD=EMBL.DELLYv0.6.8;CHR2=chr12;END=100419669;CT=3to5;INSLEN=0;PE=28;MAPQ=34;SR=30;SRQ=1;CONSENSUS=GTGCATACATTTCAGTGACCCGTTTTAGAAACAGAATTAATATGGTGAATAGAGAAAGAAGAAATCAGTGACTTTGGCCAGGCACAGTAGCTCACATCTGTAATCCCAGCACTTTGGGAGGCTGAGACAGTTGGTTGCTTGAGCCCAGGAGT"))) at test-BreakpointGRanges.R:93:8 2. ├─StructuralVariantAnnotation:::.testrecord(c("chr12\t6905246\tDEL00000292\tN\t<DEL>\t.\tPASS\tPRECISE;CIEND=-52,52;CIPOS=-52,52;SVTYPE=DEL;SVMETHOD=EMBL.DELLYv0.6.8;CHR2=chr12;END=100419669;CT=3to5;INSLEN=0;PE=28;MAPQ=34;SR=30;SRQ=1;CONSENSUS=GTGCATACATTTCAGTGACCCGTTTTAGAAACAGAATTAATATGGTGAATAGAGAAAGAAGAAATCAGTGACTTTGGCCAGGCACAGTAGCTCACATCTGTAATCCCAGCACTTTGGGAGGCTGAGACAGTTGGTTGCTTGAGCCCAGGAGT")) 3. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 4. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 5. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 6. │ └─VariantAnnotation:::.readVcf(...) 7. │ └─VariantAnnotation:::.scanVcfToVCF(...) 8. │ ├─VariantAnnotation::scanVcfHeader(file) 9. │ └─VariantAnnotation::scanVcfHeader(file) 10. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 11. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 12. │ └─BiocGenerics::Map(...) 13. │ ├─BiocGenerics (local) standardGeneric("Map") 14. │ │ ├─BiocGenerics::eval(mc, env) 15. │ │ └─base::eval(mc, env) 16. │ │ └─base::eval(mc, env) 17. │ └─base::Map(f = f, ...) 18. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 19. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 20. │ ├─Rsamtools::scanBcfHeader(bf) 21. │ └─Rsamtools::scanBcfHeader(bf) 22. └─base::.handleSimpleError(...) 23. └─base (local) h(simpleError(msg, call)) ── Error ('test-BreakpointGRanges.R:105'): countBreakpointOverlaps ───────────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─testthat::expect_equal(...) at test-BreakpointGRanges.R:105:2 2. │ └─testthat::quasi_label(enquo(object), label, arg = "object") 3. │ └─rlang::eval_bare(expr, quo_get_env(quo)) 4. ├─StructuralVariantAnnotation::countBreakpointOverlaps(...) 5. ├─StructuralVariantAnnotation::breakpointRanges(...) 6. ├─StructuralVariantAnnotation:::.testrecord(...) 7. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 8. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 9. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 10. │ └─VariantAnnotation:::.readVcf(...) 11. │ └─VariantAnnotation:::.scanVcfToVCF(...) 12. │ ├─VariantAnnotation::scanVcfHeader(file) 13. │ └─VariantAnnotation::scanVcfHeader(file) 14. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 15. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 16. │ └─BiocGenerics::Map(...) 17. │ ├─BiocGenerics (local) standardGeneric("Map") 18. │ │ ├─BiocGenerics::eval(mc, env) 19. │ │ └─base::eval(mc, env) 20. │ │ └─base::eval(mc, env) 21. │ └─base::Map(f = f, ...) 22. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 23. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 24. │ ├─Rsamtools::scanBcfHeader(bf) 25. │ └─Rsamtools::scanBcfHeader(bf) 26. └─base::.handleSimpleError(...) 27. └─base (local) h(simpleError(msg, call)) ── Error ('test-BreakpointGRanges.R:118'): countBreakpointOverlaps uniqueAllocation ── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─testthat::expect_equal(...) at test-BreakpointGRanges.R:118:2 2. │ └─testthat::quasi_label(enquo(object), label, arg = "object") 3. │ └─rlang::eval_bare(expr, quo_get_env(quo)) 4. ├─StructuralVariantAnnotation::countBreakpointOverlaps(...) 5. ├─StructuralVariantAnnotation::breakpointRanges(...) 6. ├─StructuralVariantAnnotation:::.testrecord(...) 7. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 8. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 9. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 10. │ └─VariantAnnotation:::.readVcf(...) 11. │ └─VariantAnnotation:::.scanVcfToVCF(...) 12. │ ├─VariantAnnotation::scanVcfHeader(file) 13. │ └─VariantAnnotation::scanVcfHeader(file) 14. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 15. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 16. │ └─BiocGenerics::Map(...) 17. │ ├─BiocGenerics (local) standardGeneric("Map") 18. │ │ ├─BiocGenerics::eval(mc, env) 19. │ │ └─base::eval(mc, env) 20. │ │ └─base::eval(mc, env) 21. │ └─base::Map(f = f, ...) 22. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 23. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 24. │ ├─Rsamtools::scanBcfHeader(bf) 25. │ └─Rsamtools::scanBcfHeader(bf) 26. └─base::.handleSimpleError(...) 27. └─base (local) h(simpleError(msg, call)) ── Error ('test-BreakpointGRanges.R:132'): extractBreakpointSequence ─────────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─testthat::expect_equal(...) at test-BreakpointGRanges.R:132:2 2. │ └─testthat::quasi_label(enquo(object), label, arg = "object") 3. │ └─rlang::eval_bare(expr, quo_get_env(quo)) 4. ├─StructuralVariantAnnotation::extractBreakpointSequence(...) 5. │ └─StructuralVariantAnnotation::extractReferenceSequence(...) 6. │ ├─assertthat::assert_that(is(gr, "GRanges")) 7. │ │ └─assertthat::see_if(..., env = env, msg = msg) 8. │ │ ├─base::tryCatch(...) 9. │ │ │ └─base (local) tryCatchList(expr, classes, parentenv, handlers) 10. │ │ │ └─base (local) tryCatchOne(expr, names, parentenv, handlers[[1L]]) 11. │ │ │ └─base (local) doTryCatch(return(expr), name, parentenv, handler) 12. │ │ └─base::eval(assertion, env) 13. │ │ └─base::eval(assertion, env) 14. │ └─methods::is(gr, "GRanges") 15. ├─StructuralVariantAnnotation::breakpointRanges(...) 16. ├─StructuralVariantAnnotation:::.testrecord(...) 17. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 18. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 19. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 20. │ └─VariantAnnotation:::.readVcf(...) 21. │ └─VariantAnnotation:::.scanVcfToVCF(...) 22. │ ├─VariantAnnotation::scanVcfHeader(file) 23. │ └─VariantAnnotation::scanVcfHeader(file) 24. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 25. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 26. │ └─BiocGenerics::Map(...) 27. │ ├─BiocGenerics (local) standardGeneric("Map") 28. │ │ ├─BiocGenerics::eval(mc, env) 29. │ │ └─base::eval(mc, env) 30. │ │ └─base::eval(mc, env) 31. │ └─base::Map(f = f, ...) 32. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 33. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 34. │ ├─Rsamtools::scanBcfHeader(bf) 35. │ └─Rsamtools::scanBcfHeader(bf) 36. └─base::.handleSimpleError(...) 37. └─base (local) h(simpleError(msg, call)) ── Error ('test-BreakpointGRanges.R:168'): extractReferenceSequence ──────────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─testthat::expect_equal(...) at test-BreakpointGRanges.R:168:2 2. │ └─testthat::quasi_label(enquo(object), label, arg = "object") 3. │ └─rlang::eval_bare(expr, quo_get_env(quo)) 4. ├─StructuralVariantAnnotation::extractReferenceSequence(...) 5. │ ├─assertthat::assert_that(is(gr, "GRanges")) 6. │ │ └─assertthat::see_if(..., env = env, msg = msg) 7. │ │ ├─base::tryCatch(...) 8. │ │ │ └─base (local) tryCatchList(expr, classes, parentenv, handlers) 9. │ │ │ └─base (local) tryCatchOne(expr, names, parentenv, handlers[[1L]]) 10. │ │ │ └─base (local) doTryCatch(return(expr), name, parentenv, handler) 11. │ │ └─base::eval(assertion, env) 12. │ │ └─base::eval(assertion, env) 13. │ └─methods::is(gr, "GRanges") 14. ├─StructuralVariantAnnotation::breakpointRanges(...) 15. ├─StructuralVariantAnnotation:::.testrecord(...) 16. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 17. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 18. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 19. │ └─VariantAnnotation:::.readVcf(...) 20. │ └─VariantAnnotation:::.scanVcfToVCF(...) 21. │ ├─VariantAnnotation::scanVcfHeader(file) 22. │ └─VariantAnnotation::scanVcfHeader(file) 23. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 24. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 25. │ └─BiocGenerics::Map(...) 26. │ ├─BiocGenerics (local) standardGeneric("Map") 27. │ │ ├─BiocGenerics::eval(mc, env) 28. │ │ └─base::eval(mc, env) 29. │ │ └─base::eval(mc, env) 30. │ └─base::Map(f = f, ...) 31. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 32. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 33. │ ├─Rsamtools::scanBcfHeader(bf) 34. │ └─Rsamtools::scanBcfHeader(bf) 35. └─base::.handleSimpleError(...) 36. └─base (local) h(simpleError(msg, call)) ── Error ('test-BreakpointGRanges.R:192'): calculateReferenceHomology ────────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─testthat::expect_gte(...) at test-BreakpointGRanges.R:192:2 2. │ └─testthat::quasi_label(enquo(object), label, arg = "object") 3. │ └─rlang::eval_bare(expr, quo_get_env(quo)) 4. ├─StructuralVariantAnnotation::calculateReferenceHomology(...) 5. │ ├─StructuralVariantAnnotation:::.replaceNa(...) 6. │ └─BiocGenerics::pmin(anchorLength, abs(gr$svLen) + 1) 7. │ └─BiocGenerics (local) standardGeneric("pmin") 8. │ ├─BiocGenerics::eval(quote(list(...)), env) 9. │ └─base::eval(quote(list(...)), env) 10. │ └─base::eval(quote(list(...)), env) 11. ├─StructuralVariantAnnotation::breakpointRanges(...) 12. ├─StructuralVariantAnnotation:::.testrecord(...) 13. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 14. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 15. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 16. │ └─VariantAnnotation:::.readVcf(...) 17. │ └─VariantAnnotation:::.scanVcfToVCF(...) 18. │ ├─VariantAnnotation::scanVcfHeader(file) 19. │ └─VariantAnnotation::scanVcfHeader(file) 20. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 21. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 22. │ └─BiocGenerics::Map(...) 23. │ ├─BiocGenerics (local) standardGeneric("Map") 24. │ │ ├─BiocGenerics::eval(mc, env) 25. │ │ └─base::eval(mc, env) 26. │ │ └─base::eval(mc, env) 27. │ └─base::Map(f = f, ...) 28. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 29. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 30. │ ├─Rsamtools::scanBcfHeader(bf) 31. │ └─Rsamtools::scanBcfHeader(bf) 32. └─base::.handleSimpleError(...) 33. └─base (local) h(simpleError(msg, call)) ── Error ('test-BreakpointGRanges.R:253'): simpleEventLength ─────────────────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─testthat::expect_equal(...) at test-BreakpointGRanges.R:253:8 2. │ └─testthat::quasi_label(enquo(object), label, arg = "object") 3. │ └─rlang::eval_bare(expr, quo_get_env(quo)) 4. ├─StructuralVariantAnnotation::simpleEventLength(...) 5. ├─StructuralVariantAnnotation::breakpointRanges(...) 6. ├─StructuralVariantAnnotation:::.testrecord(...) 7. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 8. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 9. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 10. │ └─VariantAnnotation:::.readVcf(...) 11. │ └─VariantAnnotation:::.scanVcfToVCF(...) 12. │ ├─VariantAnnotation::scanVcfHeader(file) 13. │ └─VariantAnnotation::scanVcfHeader(file) 14. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 15. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 16. │ └─BiocGenerics::Map(...) 17. │ ├─BiocGenerics (local) standardGeneric("Map") 18. │ │ ├─BiocGenerics::eval(mc, env) 19. │ │ └─base::eval(mc, env) 20. │ │ └─base::eval(mc, env) 21. │ └─base::Map(f = f, ...) 22. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 23. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 24. │ ├─Rsamtools::scanBcfHeader(bf) 25. │ └─Rsamtools::scanBcfHeader(bf) 26. └─base::.handleSimpleError(...) 27. └─base (local) h(simpleError(msg, call)) ── Error ('test-BreakpointGRanges.R:265'): simpleEventType ───────────────────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─testthat::expect_equal(...) at test-BreakpointGRanges.R:265:8 2. │ └─testthat::quasi_label(enquo(object), label, arg = "object") 3. │ └─rlang::eval_bare(expr, quo_get_env(quo)) 4. ├─StructuralVariantAnnotation::simpleEventType(...) 5. ├─StructuralVariantAnnotation::breakpointRanges(...) 6. ├─StructuralVariantAnnotation:::.testrecord(...) 7. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 8. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 9. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 10. │ └─VariantAnnotation:::.readVcf(...) 11. │ └─VariantAnnotation:::.scanVcfToVCF(...) 12. │ ├─VariantAnnotation::scanVcfHeader(file) 13. │ └─VariantAnnotation::scanVcfHeader(file) 14. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 15. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 16. │ └─BiocGenerics::Map(...) 17. │ ├─BiocGenerics (local) standardGeneric("Map") 18. │ │ ├─BiocGenerics::eval(mc, env) 19. │ │ └─base::eval(mc, env) 20. │ │ └─base::eval(mc, env) 21. │ └─base::Map(f = f, ...) 22. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 23. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 24. │ ├─Rsamtools::scanBcfHeader(bf) 25. │ └─Rsamtools::scanBcfHeader(bf) 26. └─base::.handleSimpleError(...) 27. └─base (local) h(simpleError(msg, call)) ── Error ('test-BreakpointGRanges.R:286'): findInsDupOverlaps ────────────────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─StructuralVariantAnnotation::breakpointRanges(...) at test-BreakpointGRanges.R:286:8 2. ├─StructuralVariantAnnotation:::.testrecord(...) 3. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 4. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 5. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 6. │ └─VariantAnnotation:::.readVcf(...) 7. │ └─VariantAnnotation:::.scanVcfToVCF(...) 8. │ ├─VariantAnnotation::scanVcfHeader(file) 9. │ └─VariantAnnotation::scanVcfHeader(file) 10. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 11. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 12. │ └─BiocGenerics::Map(...) 13. │ ├─BiocGenerics (local) standardGeneric("Map") 14. │ │ ├─BiocGenerics::eval(mc, env) 15. │ │ └─base::eval(mc, env) 16. │ │ └─base::eval(mc, env) 17. │ └─base::Map(f = f, ...) 18. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 19. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 20. │ ├─Rsamtools::scanBcfHeader(bf) 21. │ └─Rsamtools::scanBcfHeader(bf) 22. └─base::.handleSimpleError(...) 23. └─base (local) h(simpleError(msg, call)) ── Error ('test-BreakpointGRanges.R:315'): findTransitiveCalls imprecise ─────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─StructuralVariantAnnotation::breakpointRanges(...) at test-BreakpointGRanges.R:315:8 2. ├─StructuralVariantAnnotation:::.testrecord(...) 3. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 4. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 5. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 6. │ └─VariantAnnotation:::.readVcf(...) 7. │ └─VariantAnnotation:::.scanVcfToVCF(...) 8. │ ├─VariantAnnotation::scanVcfHeader(file) 9. │ └─VariantAnnotation::scanVcfHeader(file) 10. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 11. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 12. │ └─BiocGenerics::Map(...) 13. │ ├─BiocGenerics (local) standardGeneric("Map") 14. │ │ ├─BiocGenerics::eval(mc, env) 15. │ │ └─base::eval(mc, env) 16. │ │ └─base::eval(mc, env) 17. │ └─base::Map(f = f, ...) 18. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 19. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 20. │ ├─Rsamtools::scanBcfHeader(bf) 21. │ └─Rsamtools::scanBcfHeader(bf) 22. └─base::.handleSimpleError(...) 23. └─base (local) h(simpleError(msg, call)) ── Error ('test-BreakpointGRanges.R:332'): findTransitiveCalls loop ──────────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─StructuralVariantAnnotation::breakpointRanges(...) at test-BreakpointGRanges.R:332:8 2. ├─StructuralVariantAnnotation:::.testrecord(...) 3. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 4. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 5. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 6. │ └─VariantAnnotation:::.readVcf(...) 7. │ └─VariantAnnotation:::.scanVcfToVCF(...) 8. │ ├─VariantAnnotation::scanVcfHeader(file) 9. │ └─VariantAnnotation::scanVcfHeader(file) 10. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 11. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 12. │ └─BiocGenerics::Map(...) 13. │ ├─BiocGenerics (local) standardGeneric("Map") 14. │ │ ├─BiocGenerics::eval(mc, env) 15. │ │ └─base::eval(mc, env) 16. │ │ └─base::eval(mc, env) 17. │ └─base::Map(f = f, ...) 18. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 19. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 20. │ ├─Rsamtools::scanBcfHeader(bf) 21. │ └─Rsamtools::scanBcfHeader(bf) 22. └─base::.handleSimpleError(...) 23. └─base (local) h(simpleError(msg, call)) ── Error ('test-BreakpointGRanges.R:373'): .traversable_segments ─────────────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─StructuralVariantAnnotation::breakpointRanges(...) at test-BreakpointGRanges.R:373:8 2. ├─StructuralVariantAnnotation:::.testrecord(...) 3. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 4. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 5. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 6. │ └─VariantAnnotation:::.readVcf(...) 7. │ └─VariantAnnotation:::.scanVcfToVCF(...) 8. │ ├─VariantAnnotation::scanVcfHeader(file) 9. │ └─VariantAnnotation::scanVcfHeader(file) 10. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 11. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 12. │ └─BiocGenerics::Map(...) 13. │ ├─BiocGenerics (local) standardGeneric("Map") 14. │ │ ├─BiocGenerics::eval(mc, env) 15. │ │ └─base::eval(mc, env) 16. │ │ └─base::eval(mc, env) 17. │ └─base::Map(f = f, ...) 18. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 19. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 20. │ ├─Rsamtools::scanBcfHeader(bf) 21. │ └─Rsamtools::scanBcfHeader(bf) 22. └─base::.handleSimpleError(...) 23. └─base (local) h(simpleError(msg, call)) ── Error ('test-BreakpointGRanges.R:426'): findTransitiveCalls precise ───────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─StructuralVariantAnnotation::breakpointRanges(...) at test-BreakpointGRanges.R:426:8 2. ├─StructuralVariantAnnotation:::.testrecord(...) 3. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 4. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 5. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 6. │ └─VariantAnnotation:::.readVcf(...) 7. │ └─VariantAnnotation:::.scanVcfToVCF(...) 8. │ ├─VariantAnnotation::scanVcfHeader(file) 9. │ └─VariantAnnotation::scanVcfHeader(file) 10. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 11. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 12. │ └─BiocGenerics::Map(...) 13. │ ├─BiocGenerics (local) standardGeneric("Map") 14. │ │ ├─BiocGenerics::eval(mc, env) 15. │ │ └─base::eval(mc, env) 16. │ │ └─base::eval(mc, env) 17. │ └─base::Map(f = f, ...) 18. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 19. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 20. │ ├─Rsamtools::scanBcfHeader(bf) 21. │ └─Rsamtools::scanBcfHeader(bf) 22. └─base::.handleSimpleError(...) 23. └─base (local) h(simpleError(msg, call)) ── Error ('test-extensions-VCF.R:28'): INFO column import ────────────────────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─StructuralVariantAnnotation::breakpointRanges(.testrecord(c("chr10\t2991435\tINV\tN\t<INV>\t.\tLowQual\tSVTYPE=INV;CHR2=chr1;END=19357517;CT=3to5"))) at test-extensions-VCF.R:28:8 2. ├─StructuralVariantAnnotation:::.testrecord(c("chr10\t2991435\tINV\tN\t<INV>\t.\tLowQual\tSVTYPE=INV;CHR2=chr1;END=19357517;CT=3to5")) 3. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 4. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 5. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 6. │ └─VariantAnnotation:::.readVcf(...) 7. │ └─VariantAnnotation:::.scanVcfToVCF(...) 8. │ ├─VariantAnnotation::scanVcfHeader(file) 9. │ └─VariantAnnotation::scanVcfHeader(file) 10. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 11. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 12. │ └─BiocGenerics::Map(...) 13. │ ├─BiocGenerics (local) standardGeneric("Map") 14. │ │ ├─BiocGenerics::eval(mc, env) 15. │ │ └─base::eval(mc, env) 16. │ │ └─base::eval(mc, env) 17. │ └─base::Map(f = f, ...) 18. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 19. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 20. │ ├─Rsamtools::scanBcfHeader(bf) 21. │ └─Rsamtools::scanBcfHeader(bf) 22. └─base::.handleSimpleError(...) 23. └─base (local) h(simpleError(msg, call)) ── Error ('test-extensions-VCF.R:49'): Delly TRA ─────────────────────────────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─StructuralVariantAnnotation::breakpointRanges(.testrecord(c("chr10\t2991435\tTRA00000001\tN\t<TRA>\t.\tLowQual\tCIEND=0,100;CIPOS=0,50;SVTYPE=TRA;CHR2=chr1;END=19357517;CT=3to5"))) at test-extensions-VCF.R:49:4 2. ├─StructuralVariantAnnotation:::.testrecord(c("chr10\t2991435\tTRA00000001\tN\t<TRA>\t.\tLowQual\tCIEND=0,100;CIPOS=0,50;SVTYPE=TRA;CHR2=chr1;END=19357517;CT=3to5")) 3. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 4. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 5. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 6. │ └─VariantAnnotation:::.readVcf(...) 7. │ └─VariantAnnotation:::.scanVcfToVCF(...) 8. │ ├─VariantAnnotation::scanVcfHeader(file) 9. │ └─VariantAnnotation::scanVcfHeader(file) 10. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 11. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 12. │ └─BiocGenerics::Map(...) 13. │ ├─BiocGenerics (local) standardGeneric("Map") 14. │ │ ├─BiocGenerics::eval(mc, env) 15. │ │ └─base::eval(mc, env) 16. │ │ └─base::eval(mc, env) 17. │ └─base::Map(f = f, ...) 18. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 19. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 20. │ ├─Rsamtools::scanBcfHeader(bf) 21. │ └─Rsamtools::scanBcfHeader(bf) 22. └─base::.handleSimpleError(...) 23. └─base (local) h(simpleError(msg, call)) ── Error ('test-extensions-VCF.R:71'): empty VCF ─────────────────────────────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─testthat::expect_equal(0, length(breakpointRanges(.testrecord(c())))) at test-extensions-VCF.R:71:8 2. │ └─testthat::quasi_label(enquo(expected), expected.label, arg = "expected") 3. │ └─rlang::eval_bare(expr, quo_get_env(quo)) 4. ├─StructuralVariantAnnotation::breakpointRanges(.testrecord(c())) 5. ├─StructuralVariantAnnotation:::.testrecord(c()) 6. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 7. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 8. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 9. │ └─VariantAnnotation:::.readVcf(...) 10. │ └─VariantAnnotation:::.scanVcfToVCF(...) 11. │ ├─VariantAnnotation::scanVcfHeader(file) 12. │ └─VariantAnnotation::scanVcfHeader(file) 13. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 14. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 15. │ └─BiocGenerics::Map(...) 16. │ ├─BiocGenerics (local) standardGeneric("Map") 17. │ │ ├─BiocGenerics::eval(mc, env) 18. │ │ └─base::eval(mc, env) 19. │ │ └─base::eval(mc, env) 20. │ └─base::Map(f = f, ...) 21. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 22. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 23. │ ├─Rsamtools::scanBcfHeader(bf) 24. │ └─Rsamtools::scanBcfHeader(bf) 25. └─base::.handleSimpleError(...) 26. └─base (local) h(simpleError(msg, call)) ── Error ('test-extensions-VCF.R:86'): isStructural ──────────────────────────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'isStructural': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─testthat::expect_true(isStructural(.testrecord("chr1\t1\t.\tATT\tAGGA\t.\t.\t"))) at test-extensions-VCF.R:86:8 2. │ └─testthat::quasi_label(enquo(object), label, arg = "object") 3. │ └─rlang::eval_bare(expr, quo_get_env(quo)) 4. ├─StructuralVariantAnnotation::isStructural(.testrecord("chr1\t1\t.\tATT\tAGGA\t.\t.\t")) 5. ├─StructuralVariantAnnotation:::.testrecord("chr1\t1\t.\tATT\tAGGA\t.\t.\t") 6. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 7. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 8. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 9. │ └─VariantAnnotation:::.readVcf(...) 10. │ └─VariantAnnotation:::.scanVcfToVCF(...) 11. │ ├─VariantAnnotation::scanVcfHeader(file) 12. │ └─VariantAnnotation::scanVcfHeader(file) 13. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 14. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 15. │ └─BiocGenerics::Map(...) 16. │ ├─BiocGenerics (local) standardGeneric("Map") 17. │ │ ├─BiocGenerics::eval(mc, env) 18. │ │ └─base::eval(mc, env) 19. │ │ └─base::eval(mc, env) 20. │ └─base::Map(f = f, ...) 21. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 22. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 23. │ ├─Rsamtools::scanBcfHeader(bf) 24. │ └─Rsamtools::scanBcfHeader(bf) 25. └─base::.handleSimpleError(...) 26. └─base (local) h(simpleError(msg, call)) ── Error ('test-extensions-VCF.R:91'): .svLen ────────────────────────────────── Error in `scanBcfHeader(bf)`: no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─testthat::expect_equal(...) at test-extensions-VCF.R:91:8 2. │ └─testthat::quasi_label(enquo(object), label, arg = "object") 3. │ └─rlang::eval_bare(expr, quo_get_env(quo)) 4. ├─StructuralVariantAnnotation:::.svLen(.testrecord("chr1\t100\t.\tA\t<DEL>\t.\t.\tSVLEN=-1")) 5. │ ├─assertthat::assert_that(.hasSingleAllelePerRecord(vcf)) 6. │ │ └─assertthat::see_if(..., env = env, msg = msg) 7. │ │ ├─base::tryCatch(...) 8. │ │ │ └─base (local) tryCatchList(expr, classes, parentenv, handlers) 9. │ │ │ └─base (local) tryCatchOne(expr, names, parentenv, handlers[[1L]]) 10. │ │ │ └─base (local) doTryCatch(return(expr), name, parentenv, handler) 11. │ │ └─base::eval(assertion, env) 12. │ │ └─base::eval(assertion, env) 13. │ └─StructuralVariantAnnotation:::.hasSingleAllelePerRecord(vcf) 14. │ ├─assertthat::assert_that(is(vcf, "VCF")) 15. │ │ └─assertthat::see_if(..., env = env, msg = msg) 16. │ │ ├─base::tryCatch(...) 17. │ │ │ └─base (local) tryCatchList(expr, classes, parentenv, handlers) 18. │ │ │ └─base (local) tryCatchOne(expr, names, parentenv, handlers[[1L]]) 19. │ │ │ └─base (local) doTryCatch(return(expr), name, parentenv, handler) 20. │ │ └─base::eval(assertion, env) 21. │ │ └─base::eval(assertion, env) 22. │ └─methods::is(vcf, "VCF") 23. └─StructuralVariantAnnotation:::.testrecord("chr1\t100\t.\tA\t<DEL>\t.\t.\tSVLEN=-1") 24. ├─VariantAnnotation::readVcf(.testfile(filename), "") 25. └─VariantAnnotation::readVcf(.testfile(filename), "") 26. └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 27. └─VariantAnnotation:::.readVcf(...) 28. └─VariantAnnotation:::.scanVcfToVCF(...) 29. ├─VariantAnnotation::scanVcfHeader(file) 30. └─VariantAnnotation::scanVcfHeader(file) 31. ├─Rsamtools::scanBcfHeader(file[[1]], ...) 32. └─Rsamtools::scanBcfHeader(file[[1]], ...) 33. └─BiocGenerics::Map(...) 34. ├─BiocGenerics (local) standardGeneric("Map") 35. │ ├─BiocGenerics::eval(mc, env) 36. │ └─base::eval(mc, env) 37. │ └─base::eval(mc, env) 38. └─base::Map(f = f, ...) 39. └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 40. └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 41. ├─Rsamtools::scanBcfHeader(bf) 42. └─Rsamtools::scanBcfHeader(bf) ── Error ('test-extensions-VCF.R:107'): breakpointRanges creates placeholder names ── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─testthat::expect_warning(...) at test-extensions-VCF.R:107:8 2. │ └─testthat:::quasi_capture(...) 3. │ ├─testthat (local) .capture(...) 4. │ │ └─base::withCallingHandlers(...) 5. │ └─rlang::eval_bare(quo_get_expr(.quo), quo_get_env(.quo)) 6. ├─testthat::expect_named(...) 7. │ └─testthat::quasi_label(enquo(object), label, arg = "object") 8. │ └─rlang::eval_bare(expr, quo_get_env(quo)) 9. ├─StructuralVariantAnnotation::breakpointRanges(...) 10. ├─StructuralVariantAnnotation:::.testrecord(...) 11. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 12. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 13. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 14. │ └─VariantAnnotation:::.readVcf(...) 15. │ └─VariantAnnotation:::.scanVcfToVCF(...) 16. │ ├─VariantAnnotation::scanVcfHeader(file) 17. │ └─VariantAnnotation::scanVcfHeader(file) 18. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 19. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 20. │ └─BiocGenerics::Map(...) 21. │ ├─BiocGenerics (local) standardGeneric("Map") 22. │ │ ├─BiocGenerics::eval(mc, env) 23. │ │ └─base::eval(mc, env) 24. │ │ └─base::eval(mc, env) 25. │ └─base::Map(f = f, ...) 26. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 27. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 28. │ ├─Rsamtools::scanBcfHeader(bf) 29. │ └─Rsamtools::scanBcfHeader(bf) 30. └─base::.handleSimpleError(...) 31. └─base (local) h(simpleError(msg, call)) ── Error ('test-extensions-VCF.R:116'): breakpointRanges non-symbolic alleles ── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─StructuralVariantAnnotation::breakpointRanges(.testrecord("chr1\t1\t.\tATT\tAGGA\t.\t.\t")) at test-extensions-VCF.R:116:8 2. ├─StructuralVariantAnnotation:::.testrecord("chr1\t1\t.\tATT\tAGGA\t.\t.\t") 3. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 4. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 5. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 6. │ └─VariantAnnotation:::.readVcf(...) 7. │ └─VariantAnnotation:::.scanVcfToVCF(...) 8. │ ├─VariantAnnotation::scanVcfHeader(file) 9. │ └─VariantAnnotation::scanVcfHeader(file) 10. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 11. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 12. │ └─BiocGenerics::Map(...) 13. │ ├─BiocGenerics (local) standardGeneric("Map") 14. │ │ ├─BiocGenerics::eval(mc, env) 15. │ │ └─base::eval(mc, env) 16. │ │ └─base::eval(mc, env) 17. │ └─base::Map(f = f, ...) 18. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 19. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 20. │ ├─Rsamtools::scanBcfHeader(bf) 21. │ └─Rsamtools::scanBcfHeader(bf) 22. └─base::.handleSimpleError(...) 23. └─base (local) h(simpleError(msg, call)) ── Error ('test-extensions-VCF.R:140'): breakpointRanges intervals ───────────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─StructuralVariantAnnotation::breakpointRanges(.testrecord("chr1\t100\t.\tA\tAT\t.\t.\tHOMLEN=0")) at test-extensions-VCF.R:140:8 2. ├─StructuralVariantAnnotation:::.testrecord("chr1\t100\t.\tA\tAT\t.\t.\tHOMLEN=0") 3. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 4. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 5. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 6. │ └─VariantAnnotation:::.readVcf(...) 7. │ └─VariantAnnotation:::.scanVcfToVCF(...) 8. │ ├─VariantAnnotation::scanVcfHeader(file) 9. │ └─VariantAnnotation::scanVcfHeader(file) 10. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 11. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 12. │ └─BiocGenerics::Map(...) 13. │ ├─BiocGenerics (local) standardGeneric("Map") 14. │ │ ├─BiocGenerics::eval(mc, env) 15. │ │ └─base::eval(mc, env) 16. │ │ └─base::eval(mc, env) 17. │ └─base::Map(f = f, ...) 18. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 19. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 20. │ ├─Rsamtools::scanBcfHeader(bf) 21. │ └─Rsamtools::scanBcfHeader(bf) 22. └─base::.handleSimpleError(...) 23. └─base (local) h(simpleError(msg, call)) ── Error ('test-extensions-VCF.R:171'): breakpointRanges DEL ─────────────────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─StructuralVariantAnnotation::breakpointRanges(.testrecord("chr1\t100\t.\tA\t<DEL>\t.\t.\tSVLEN=-1")) at test-extensions-VCF.R:171:8 2. ├─StructuralVariantAnnotation:::.testrecord("chr1\t100\t.\tA\t<DEL>\t.\t.\tSVLEN=-1") 3. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 4. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 5. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 6. │ └─VariantAnnotation:::.readVcf(...) 7. │ └─VariantAnnotation:::.scanVcfToVCF(...) 8. │ ├─VariantAnnotation::scanVcfHeader(file) 9. │ └─VariantAnnotation::scanVcfHeader(file) 10. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 11. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 12. │ └─BiocGenerics::Map(...) 13. │ ├─BiocGenerics (local) standardGeneric("Map") 14. │ │ ├─BiocGenerics::eval(mc, env) 15. │ │ └─base::eval(mc, env) 16. │ │ └─base::eval(mc, env) 17. │ └─base::Map(f = f, ...) 18. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 19. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 20. │ ├─Rsamtools::scanBcfHeader(bf) 21. │ └─Rsamtools::scanBcfHeader(bf) 22. └─base::.handleSimpleError(...) 23. └─base (local) h(simpleError(msg, call)) ── Error ('test-extensions-VCF.R:185'): breakpointRanges should fix positive DEL event size ── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─StructuralVariantAnnotation::breakpointRanges(.testrecord("chr1\t100\t.\tA\t<DEL>\t.\t.\tSVLEN=10")) at test-extensions-VCF.R:185:8 2. ├─StructuralVariantAnnotation:::.testrecord("chr1\t100\t.\tA\t<DEL>\t.\t.\tSVLEN=10") 3. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 4. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 5. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 6. │ └─VariantAnnotation:::.readVcf(...) 7. │ └─VariantAnnotation:::.scanVcfToVCF(...) 8. │ ├─VariantAnnotation::scanVcfHeader(file) 9. │ └─VariantAnnotation::scanVcfHeader(file) 10. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 11. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 12. │ └─BiocGenerics::Map(...) 13. │ ├─BiocGenerics (local) standardGeneric("Map") 14. │ │ ├─BiocGenerics::eval(mc, env) 15. │ │ └─base::eval(mc, env) 16. │ │ └─base::eval(mc, env) 17. │ └─base::Map(f = f, ...) 18. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 19. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 20. │ ├─Rsamtools::scanBcfHeader(bf) 21. │ └─Rsamtools::scanBcfHeader(bf) 22. └─base::.handleSimpleError(...) 23. └─base (local) h(simpleError(msg, call)) ── Error ('test-extensions-VCF.R:196'): breakpointRanges breakend ────────────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─testthat::expect_equal(...) at test-extensions-VCF.R:196:8 2. │ └─testthat::quasi_label(enquo(object), label, arg = "object") 3. │ └─rlang::eval_bare(expr, quo_get_env(quo)) 4. ├─StructuralVariantAnnotation::breakpointRanges(...) 5. ├─StructuralVariantAnnotation:::.testrecord(...) 6. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 7. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 8. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 9. │ └─VariantAnnotation:::.readVcf(...) 10. │ └─VariantAnnotation:::.scanVcfToVCF(...) 11. │ ├─VariantAnnotation::scanVcfHeader(file) 12. │ └─VariantAnnotation::scanVcfHeader(file) 13. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 14. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 15. │ └─BiocGenerics::Map(...) 16. │ ├─BiocGenerics (local) standardGeneric("Map") 17. │ │ ├─BiocGenerics::eval(mc, env) 18. │ │ └─base::eval(mc, env) 19. │ │ └─base::eval(mc, env) 20. │ └─base::Map(f = f, ...) 21. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 22. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 23. │ ├─Rsamtools::scanBcfHeader(bf) 24. │ └─Rsamtools::scanBcfHeader(bf) 25. └─base::.handleSimpleError(...) 26. └─base (local) h(simpleError(msg, call)) ── Error ('test-extensions-VCF.R:207'): breakpointRanges INV ─────────────────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─StructuralVariantAnnotation::breakpointRanges(.testrecord("chr1\t321682\tINV0\tT\t<INV>\t6\tPASS\tSVTYPE=INV;END=421681")) at test-extensions-VCF.R:207:8 2. ├─StructuralVariantAnnotation:::.testrecord("chr1\t321682\tINV0\tT\t<INV>\t6\tPASS\tSVTYPE=INV;END=421681") 3. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 4. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 5. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 6. │ └─VariantAnnotation:::.readVcf(...) 7. │ └─VariantAnnotation:::.scanVcfToVCF(...) 8. │ ├─VariantAnnotation::scanVcfHeader(file) 9. │ └─VariantAnnotation::scanVcfHeader(file) 10. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 11. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 12. │ └─BiocGenerics::Map(...) 13. │ ├─BiocGenerics (local) standardGeneric("Map") 14. │ │ ├─BiocGenerics::eval(mc, env) 15. │ │ └─base::eval(mc, env) 16. │ │ └─base::eval(mc, env) 17. │ └─base::Map(f = f, ...) 18. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 19. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 20. │ ├─Rsamtools::scanBcfHeader(bf) 21. │ └─Rsamtools::scanBcfHeader(bf) 22. └─base::.handleSimpleError(...) 23. └─base (local) h(simpleError(msg, call)) ── Error ('test-extensions-VCF.R:222'): breakpointRanges DUP ─────────────────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─StructuralVariantAnnotation::breakpointRanges(...) at test-extensions-VCF.R:222:8 2. ├─StructuralVariantAnnotation:::.testrecord(...) 3. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 4. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 5. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 6. │ └─VariantAnnotation:::.readVcf(...) 7. │ └─VariantAnnotation:::.scanVcfToVCF(...) 8. │ ├─VariantAnnotation::scanVcfHeader(file) 9. │ └─VariantAnnotation::scanVcfHeader(file) 10. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 11. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 12. │ └─BiocGenerics::Map(...) 13. │ ├─BiocGenerics (local) standardGeneric("Map") 14. │ │ ├─BiocGenerics::eval(mc, env) 15. │ │ └─base::eval(mc, env) 16. │ │ └─base::eval(mc, env) 17. │ └─base::Map(f = f, ...) 18. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 19. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 20. │ ├─Rsamtools::scanBcfHeader(bf) 21. │ └─Rsamtools::scanBcfHeader(bf) 22. └─base::.handleSimpleError(...) 23. └─base (local) h(simpleError(msg, call)) ── Error ('test-extensions-VCF.R:260'): nominalPosition should ignore confidence intervals ── Error in `scanBcfHeader(bf)`: no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. └─StructuralVariantAnnotation:::.testrecord(c("chr1\t100\t.\tA\t<DEL>\t14\tPASS\tSVTYPE=DEL;END=200")) at test-extensions-VCF.R:260:8 2. ├─VariantAnnotation::readVcf(.testfile(filename), "") 3. └─VariantAnnotation::readVcf(.testfile(filename), "") 4. └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 5. └─VariantAnnotation:::.readVcf(...) 6. └─VariantAnnotation:::.scanVcfToVCF(...) 7. ├─VariantAnnotation::scanVcfHeader(file) 8. └─VariantAnnotation::scanVcfHeader(file) 9. ├─Rsamtools::scanBcfHeader(file[[1]], ...) 10. └─Rsamtools::scanBcfHeader(file[[1]], ...) 11. └─BiocGenerics::Map(...) 12. ├─BiocGenerics (local) standardGeneric("Map") 13. │ ├─BiocGenerics::eval(mc, env) 14. │ └─base::eval(mc, env) 15. │ └─base::eval(mc, env) 16. └─base::Map(f = f, ...) 17. └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 18. └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 19. ├─Rsamtools::scanBcfHeader(bf) 20. └─Rsamtools::scanBcfHeader(bf) ── Error ('test-extensions-VCF.R:267'): nominalPosition should ignore micro-homology ── Error in `scanBcfHeader(bf)`: no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. └─StructuralVariantAnnotation:::.testrecord(c("chr1\t100\t.\tA\t<DEL>\t14\tPASS\tSVTYPE=DEL;END=200")) at test-extensions-VCF.R:267:8 2. ├─VariantAnnotation::readVcf(.testfile(filename), "") 3. └─VariantAnnotation::readVcf(.testfile(filename), "") 4. └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 5. └─VariantAnnotation:::.readVcf(...) 6. └─VariantAnnotation:::.scanVcfToVCF(...) 7. ├─VariantAnnotation::scanVcfHeader(file) 8. └─VariantAnnotation::scanVcfHeader(file) 9. ├─Rsamtools::scanBcfHeader(file[[1]], ...) 10. └─Rsamtools::scanBcfHeader(file[[1]], ...) 11. └─BiocGenerics::Map(...) 12. ├─BiocGenerics (local) standardGeneric("Map") 13. │ ├─BiocGenerics::eval(mc, env) 14. │ └─base::eval(mc, env) 15. │ └─base::eval(mc, env) 16. └─base::Map(f = f, ...) 17. └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 18. └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 19. ├─Rsamtools::scanBcfHeader(bf) 20. └─Rsamtools::scanBcfHeader(bf) ── Error ('test-extensions-VCF.R:272'): breakpointRanges should not include breakends ── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'isSymbolic': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─testthat::expect_true(isSymbolic(.testrecord(c("chr1\t100\t.\tA\tAAA.\t14\tPASS\tSVTYPE=BND")))) at test-extensions-VCF.R:272:8 2. │ └─testthat::quasi_label(enquo(object), label, arg = "object") 3. │ └─rlang::eval_bare(expr, quo_get_env(quo)) 4. ├─StructuralVariantAnnotation::isSymbolic(.testrecord(c("chr1\t100\t.\tA\tAAA.\t14\tPASS\tSVTYPE=BND"))) 5. ├─StructuralVariantAnnotation:::.testrecord(c("chr1\t100\t.\tA\tAAA.\t14\tPASS\tSVTYPE=BND")) 6. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 7. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 8. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 9. │ └─VariantAnnotation:::.readVcf(...) 10. │ └─VariantAnnotation:::.scanVcfToVCF(...) 11. │ ├─VariantAnnotation::scanVcfHeader(file) 12. │ └─VariantAnnotation::scanVcfHeader(file) 13. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 14. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 15. │ └─BiocGenerics::Map(...) 16. │ ├─BiocGenerics (local) standardGeneric("Map") 17. │ │ ├─BiocGenerics::eval(mc, env) 18. │ │ └─base::eval(mc, env) 19. │ │ └─base::eval(mc, env) 20. │ └─base::Map(f = f, ...) 21. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 22. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 23. │ ├─Rsamtools::scanBcfHeader(bf) 24. │ └─Rsamtools::scanBcfHeader(bf) 25. └─base::.handleSimpleError(...) 26. └─base (local) h(simpleError(msg, call)) ── Error ('test-extensions-VCF.R:277'): breakendRanges should include breakends ── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakendRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─StructuralVariantAnnotation::breakendRanges(.testrecord(c("chr1\t100\t.\tA\tTGC.\t14\tPASS\tSVTYPE=BND"))) at test-extensions-VCF.R:277:8 2. ├─StructuralVariantAnnotation:::.testrecord(c("chr1\t100\t.\tA\tTGC.\t14\tPASS\tSVTYPE=BND")) 3. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 4. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 5. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 6. │ └─VariantAnnotation:::.readVcf(...) 7. │ └─VariantAnnotation:::.scanVcfToVCF(...) 8. │ ├─VariantAnnotation::scanVcfHeader(file) 9. │ └─VariantAnnotation::scanVcfHeader(file) 10. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 11. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 12. │ └─BiocGenerics::Map(...) 13. │ ├─BiocGenerics (local) standardGeneric("Map") 14. │ │ ├─BiocGenerics::eval(mc, env) 15. │ │ └─base::eval(mc, env) 16. │ │ └─base::eval(mc, env) 17. │ └─base::Map(f = f, ...) 18. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 19. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 20. │ ├─Rsamtools::scanBcfHeader(bf) 21. │ └─Rsamtools::scanBcfHeader(bf) 22. └─base::.handleSimpleError(...) 23. └─base (local) h(simpleError(msg, call)) ── Error ('test-extensions-VCF.R:283'): align_breakpoint should handle all orientations ── Error in `scanBcfHeader(bf)`: no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. └─StructuralVariantAnnotation:::.testrecord(...) at test-extensions-VCF.R:283:8 2. ├─VariantAnnotation::readVcf(.testfile(filename), "") 3. └─VariantAnnotation::readVcf(.testfile(filename), "") 4. └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 5. └─VariantAnnotation:::.readVcf(...) 6. └─VariantAnnotation:::.scanVcfToVCF(...) 7. ├─VariantAnnotation::scanVcfHeader(file) 8. └─VariantAnnotation::scanVcfHeader(file) 9. ├─Rsamtools::scanBcfHeader(file[[1]], ...) 10. └─Rsamtools::scanBcfHeader(file[[1]], ...) 11. └─BiocGenerics::Map(...) 12. ├─BiocGenerics (local) standardGeneric("Map") 13. │ ├─BiocGenerics::eval(mc, env) 14. │ └─base::eval(mc, env) 15. │ └─base::eval(mc, env) 16. └─base::Map(f = f, ...) 17. └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 18. └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 19. ├─Rsamtools::scanBcfHeader(bf) 20. └─Rsamtools::scanBcfHeader(bf) ── Error ('test-extensions-VCF.R:321'): align_breakpoint centre should ensure odd length homology is consistent on both sides ── Error in `scanBcfHeader(bf)`: no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. └─StructuralVariantAnnotation:::.testrecord(...) at test-extensions-VCF.R:321:8 2. ├─VariantAnnotation::readVcf(.testfile(filename), "") 3. └─VariantAnnotation::readVcf(.testfile(filename), "") 4. └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 5. └─VariantAnnotation:::.readVcf(...) 6. └─VariantAnnotation:::.scanVcfToVCF(...) 7. ├─VariantAnnotation::scanVcfHeader(file) 8. └─VariantAnnotation::scanVcfHeader(file) 9. ├─Rsamtools::scanBcfHeader(file[[1]], ...) 10. └─Rsamtools::scanBcfHeader(file[[1]], ...) 11. └─BiocGenerics::Map(...) 12. ├─BiocGenerics (local) standardGeneric("Map") 13. │ ├─BiocGenerics::eval(mc, env) 14. │ └─base::eval(mc, env) 15. │ └─base::eval(mc, env) 16. └─base::Map(f = f, ...) 17. └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 18. └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 19. ├─Rsamtools::scanBcfHeader(bf) 20. └─Rsamtools::scanBcfHeader(bf) ── Error ('test-extensions-VCF.R:354'): align_breakpoint should not touch other variants ── Error in `scanBcfHeader(bf)`: no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. └─StructuralVariantAnnotation:::.testrecord(...) at test-extensions-VCF.R:354:8 2. ├─VariantAnnotation::readVcf(.testfile(filename), "") 3. └─VariantAnnotation::readVcf(.testfile(filename), "") 4. └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 5. └─VariantAnnotation:::.readVcf(...) 6. └─VariantAnnotation:::.scanVcfToVCF(...) 7. ├─VariantAnnotation::scanVcfHeader(file) 8. └─VariantAnnotation::scanVcfHeader(file) 9. ├─Rsamtools::scanBcfHeader(file[[1]], ...) 10. └─Rsamtools::scanBcfHeader(file[[1]], ...) 11. └─BiocGenerics::Map(...) 12. ├─BiocGenerics (local) standardGeneric("Map") 13. │ ├─BiocGenerics::eval(mc, env) 14. │ └─base::eval(mc, env) 15. │ └─base::eval(mc, env) 16. └─base::Map(f = f, ...) 17. └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 18. └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 19. ├─Rsamtools::scanBcfHeader(bf) 20. └─Rsamtools::scanBcfHeader(bf) ── Error ('test-extensions-VCF.R:412'): VCFv4.4 use ALT instead of SVTYPE ────── Error in `scanBcfHeader(bf)`: no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. └─StructuralVariantAnnotation:::.testrecordv44(...) at test-extensions-VCF.R:412:8 2. ├─VariantAnnotation::readVcf(.testfile(filename), "") 3. └─VariantAnnotation::readVcf(.testfile(filename), "") 4. └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 5. └─VariantAnnotation:::.readVcf(...) 6. └─VariantAnnotation:::.scanVcfToVCF(...) 7. ├─VariantAnnotation::scanVcfHeader(file) 8. └─VariantAnnotation::scanVcfHeader(file) 9. ├─Rsamtools::scanBcfHeader(file[[1]], ...) 10. └─Rsamtools::scanBcfHeader(file[[1]], ...) 11. └─BiocGenerics::Map(...) 12. ├─BiocGenerics (local) standardGeneric("Map") 13. │ ├─BiocGenerics::eval(mc, env) 14. │ └─base::eval(mc, env) 15. │ └─base::eval(mc, env) 16. └─base::Map(f = f, ...) 17. └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 18. └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 19. ├─Rsamtools::scanBcfHeader(bf) 20. └─Rsamtools::scanBcfHeader(bf) ── Error ('test-extensions-VCF.R:434'): VCFv4.4 CNV & SVCLAIM ────────────────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─StructuralVariantAnnotation::breakpointRanges(...) at test-extensions-VCF.R:434:8 2. ├─StructuralVariantAnnotation:::.testrecordv44(...) 3. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 4. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 5. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 6. │ └─VariantAnnotation:::.readVcf(...) 7. │ └─VariantAnnotation:::.scanVcfToVCF(...) 8. │ ├─VariantAnnotation::scanVcfHeader(file) 9. │ └─VariantAnnotation::scanVcfHeader(file) 10. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 11. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 12. │ └─BiocGenerics::Map(...) 13. │ ├─BiocGenerics (local) standardGeneric("Map") 14. │ │ ├─BiocGenerics::eval(mc, env) 15. │ │ └─base::eval(mc, env) 16. │ │ └─base::eval(mc, env) 17. │ └─base::Map(f = f, ...) 18. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 19. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 20. │ ├─Rsamtools::scanBcfHeader(bf) 21. │ └─Rsamtools::scanBcfHeader(bf) 22. └─base::.handleSimpleError(...) 23. └─base (local) h(simpleError(msg, call)) ── Error ('test-extensions-VCF.R:447'): VCFv4.4 SVLEN>END ────────────────────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─StructuralVariantAnnotation::breakpointRanges(...) at test-extensions-VCF.R:447:8 2. ├─StructuralVariantAnnotation:::.testrecordv44(...) 3. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 4. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 5. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 6. │ └─VariantAnnotation:::.readVcf(...) 7. │ └─VariantAnnotation:::.scanVcfToVCF(...) 8. │ ├─VariantAnnotation::scanVcfHeader(file) 9. │ └─VariantAnnotation::scanVcfHeader(file) 10. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 11. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 12. │ └─BiocGenerics::Map(...) 13. │ ├─BiocGenerics (local) standardGeneric("Map") 14. │ │ ├─BiocGenerics::eval(mc, env) 15. │ │ └─base::eval(mc, env) 16. │ │ └─base::eval(mc, env) 17. │ └─base::Map(f = f, ...) 18. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 19. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 20. │ ├─Rsamtools::scanBcfHeader(bf) 21. │ └─Rsamtools::scanBcfHeader(bf) 22. └─base::.handleSimpleError(...) 23. └─base (local) h(simpleError(msg, call)) ── Error ('test-extensions-VCF.R:456'): VCFv4.4 CIEND>CILEN DEL ──────────────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─StructuralVariantAnnotation::breakpointRanges(...) at test-extensions-VCF.R:456:8 2. ├─StructuralVariantAnnotation:::.testrecordv44(...) 3. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 4. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 5. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 6. │ └─VariantAnnotation:::.readVcf(...) 7. │ └─VariantAnnotation:::.scanVcfToVCF(...) 8. │ ├─VariantAnnotation::scanVcfHeader(file) 9. │ └─VariantAnnotation::scanVcfHeader(file) 10. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 11. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 12. │ └─BiocGenerics::Map(...) 13. │ ├─BiocGenerics (local) standardGeneric("Map") 14. │ │ ├─BiocGenerics::eval(mc, env) 15. │ │ └─base::eval(mc, env) 16. │ │ └─base::eval(mc, env) 17. │ └─base::Map(f = f, ...) 18. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 19. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 20. │ ├─Rsamtools::scanBcfHeader(bf) 21. │ └─Rsamtools::scanBcfHeader(bf) 22. └─base::.handleSimpleError(...) 23. └─base (local) h(simpleError(msg, call)) ── Error ('test-extensions-VCF.R:481'): VCFv4.4 CIEND CILEN INV ──────────────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─StructuralVariantAnnotation::breakpointRanges(...) at test-extensions-VCF.R:481:8 2. ├─StructuralVariantAnnotation:::.testrecordv44(...) 3. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 4. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 5. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 6. │ └─VariantAnnotation:::.readVcf(...) 7. │ └─VariantAnnotation:::.scanVcfToVCF(...) 8. │ ├─VariantAnnotation::scanVcfHeader(file) 9. │ └─VariantAnnotation::scanVcfHeader(file) 10. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 11. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 12. │ └─BiocGenerics::Map(...) 13. │ ├─BiocGenerics (local) standardGeneric("Map") 14. │ │ ├─BiocGenerics::eval(mc, env) 15. │ │ └─base::eval(mc, env) 16. │ │ └─base::eval(mc, env) 17. │ └─base::Map(f = f, ...) 18. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 19. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 20. │ ├─Rsamtools::scanBcfHeader(bf) 21. │ └─Rsamtools::scanBcfHeader(bf) 22. └─base::.handleSimpleError(...) 23. └─base (local) h(simpleError(msg, call)) ── Error ('test-extensions-VCF.R:490'): VCFv4.4 CIEND CILEN INS ──────────────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─StructuralVariantAnnotation::breakpointRanges(...) at test-extensions-VCF.R:490:8 2. ├─StructuralVariantAnnotation:::.testrecordv44(...) 3. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 4. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 5. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 6. │ └─VariantAnnotation:::.readVcf(...) 7. │ └─VariantAnnotation:::.scanVcfToVCF(...) 8. │ ├─VariantAnnotation::scanVcfHeader(file) 9. │ └─VariantAnnotation::scanVcfHeader(file) 10. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 11. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 12. │ └─BiocGenerics::Map(...) 13. │ ├─BiocGenerics (local) standardGeneric("Map") 14. │ │ ├─BiocGenerics::eval(mc, env) 15. │ │ └─base::eval(mc, env) 16. │ │ └─base::eval(mc, env) 17. │ └─base::Map(f = f, ...) 18. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 19. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 20. │ ├─Rsamtools::scanBcfHeader(bf) 21. │ └─Rsamtools::scanBcfHeader(bf) 22. └─base::.handleSimpleError(...) 23. └─base (local) h(simpleError(msg, call)) ── Error ('test-extensions-VCF.R:498'): VCFv4.4 ALT symbolic subtypes ────────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─StructuralVariantAnnotation::breakpointRanges(...) at test-extensions-VCF.R:498:8 2. ├─StructuralVariantAnnotation:::.testrecordv44(...) 3. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 4. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 5. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 6. │ └─VariantAnnotation:::.readVcf(...) 7. │ └─VariantAnnotation:::.scanVcfToVCF(...) 8. │ ├─VariantAnnotation::scanVcfHeader(file) 9. │ └─VariantAnnotation::scanVcfHeader(file) 10. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 11. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 12. │ └─BiocGenerics::Map(...) 13. │ ├─BiocGenerics (local) standardGeneric("Map") 14. │ │ ├─BiocGenerics::eval(mc, env) 15. │ │ └─base::eval(mc, env) 16. │ │ └─base::eval(mc, env) 17. │ └─base::Map(f = f, ...) 18. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 19. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 20. │ ├─Rsamtools::scanBcfHeader(bf) 21. │ └─Rsamtools::scanBcfHeader(bf) 22. └─base::.handleSimpleError(...) 23. └─base (local) h(simpleError(msg, call)) ── Error ('test-extensions-VCF.R:512'): VCFv4.4 EVENT ────────────────────────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─StructuralVariantAnnotation::breakpointRanges(...) at test-extensions-VCF.R:512:8 2. ├─StructuralVariantAnnotation:::.testrecordv44(...) 3. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 4. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 5. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 6. │ └─VariantAnnotation:::.readVcf(...) 7. │ └─VariantAnnotation:::.scanVcfToVCF(...) 8. │ ├─VariantAnnotation::scanVcfHeader(file) 9. │ └─VariantAnnotation::scanVcfHeader(file) 10. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 11. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 12. │ └─BiocGenerics::Map(...) 13. │ ├─BiocGenerics (local) standardGeneric("Map") 14. │ │ ├─BiocGenerics::eval(mc, env) 15. │ │ └─base::eval(mc, env) 16. │ │ └─base::eval(mc, env) 17. │ └─base::Map(f = f, ...) 18. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 19. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 20. │ ├─Rsamtools::scanBcfHeader(bf) 21. │ └─Rsamtools::scanBcfHeader(bf) 22. └─base::.handleSimpleError(...) 23. └─base (local) h(simpleError(msg, call)) ── Error ('test-extensions-VCF.R:519'): VCFv4.4 non-SV symbolic alleles ──────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─StructuralVariantAnnotation::breakpointRanges(...) at test-extensions-VCF.R:519:8 2. ├─StructuralVariantAnnotation:::.testrecordv44(...) 3. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 4. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 5. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 6. │ └─VariantAnnotation:::.readVcf(...) 7. │ └─VariantAnnotation:::.scanVcfToVCF(...) 8. │ ├─VariantAnnotation::scanVcfHeader(file) 9. │ └─VariantAnnotation::scanVcfHeader(file) 10. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 11. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 12. │ └─BiocGenerics::Map(...) 13. │ ├─BiocGenerics (local) standardGeneric("Map") 14. │ │ ├─BiocGenerics::eval(mc, env) 15. │ │ └─base::eval(mc, env) 16. │ │ └─base::eval(mc, env) 17. │ └─base::Map(f = f, ...) 18. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 19. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 20. │ ├─Rsamtools::scanBcfHeader(bf) 21. │ └─Rsamtools::scanBcfHeader(bf) 22. └─base::.handleSimpleError(...) 23. └─base (local) h(simpleError(msg, call)) ── Error ('test-extensions-VCF.R:525'): SVLEN ────────────────────────────────── Error in `h(simpleError(msg, call))`: error in evaluating the argument 'x' in selecting a method for function 'breakpointRanges': no 'header' line "#CHROM POS ID..."? Backtrace: ▆ 1. ├─StructuralVariantAnnotation::breakpointRanges(...) at test-extensions-VCF.R:525:8 2. ├─StructuralVariantAnnotation:::.testrecordv44(...) 3. │ ├─VariantAnnotation::readVcf(.testfile(filename), "") 4. │ └─VariantAnnotation::readVcf(.testfile(filename), "") 5. │ └─VariantAnnotation (local) .local(file, genome = genome, param = param, ...) 6. │ └─VariantAnnotation:::.readVcf(...) 7. │ └─VariantAnnotation:::.scanVcfToVCF(...) 8. │ ├─VariantAnnotation::scanVcfHeader(file) 9. │ └─VariantAnnotation::scanVcfHeader(file) 10. │ ├─Rsamtools::scanBcfHeader(file[[1]], ...) 11. │ └─Rsamtools::scanBcfHeader(file[[1]], ...) 12. │ └─BiocGenerics::Map(...) 13. │ ├─BiocGenerics (local) standardGeneric("Map") 14. │ │ ├─BiocGenerics::eval(mc, env) 15. │ │ └─base::eval(mc, env) 16. │ │ └─base::eval(mc, env) 17. │ └─base::Map(f = f, ...) 18. │ └─base::mapply(FUN = f, ..., SIMPLIFY = FALSE) 19. │ └─Rsamtools (local) `<fn>`(dots[[1L]][[1L]]) 20. │ ├─Rsamtools::scanBcfHeader(bf) 21. │ └─Rsamtools::scanBcfHeader(bf) 22. └─base::.handleSimpleError(...) 23. └─base (local) h(simpleError(msg, call)) [ FAIL 45 | WARN 27 | SKIP 0 | PASS 105 ] Error: Test failures Execution halted
StructuralVariantAnnotation.Rcheck/StructuralVariantAnnotation-Ex.timings
name | user | system | elapsed | |
breakendRanges | 5.836 | 0.116 | 7.794 | |
breakpointRanges | 5.895 | 0.212 | 8.156 | |
breakpointgr2bedpe | 3.487 | 0.025 | 4.647 | |
countBreakpointOverlaps | 5.012 | 0.031 | 6.540 | |
findBreakpointOverlaps | 7.273 | 0.048 | 9.776 | |
hasPartner | 3.505 | 0.040 | 4.652 | |
isStructural | 1.094 | 0.016 | 1.498 | |
isSymbolic | 1.124 | 0.020 | 1.501 | |
numtDetect | 4.008 | 0.018 | 5.177 | |
pairs2breakpointgr | 3.802 | 0.023 | 4.901 | |
partner | 3.289 | 0.022 | 4.316 | |