This page was generated on 2018-10-17 08:30:17 -0400 (Wed, 17 Oct 2018).
trena 1.2.0 Paul Shannon
Snapshot Date: 2018-10-15 16:45:08 -0400 (Mon, 15 Oct 2018) |
URL: https://git.bioconductor.org/packages/trena |
Branch: RELEASE_3_7 |
Last Commit: d75e0f5 |
Last Changed Date: 2018-04-30 10:35:46 -0400 (Mon, 30 Apr 2018) |
| malbec2 | Linux (Ubuntu 16.04.1 LTS) / x86_64 | OK | OK | [ OK ] | | ![UNNEEDED, same version exists in internal repository UNNEEDED, same version exists in internal repository](../120px-Blue_Light_Icon.svg.png) |
tokay2 | Windows Server 2012 R2 Standard / x64 | OK | OK | OK | OK | ![UNNEEDED, same version exists in internal repository UNNEEDED, same version exists in internal repository](../120px-Blue_Light_Icon.svg.png) |
merida2 | OS X 10.11.6 El Capitan / x86_64 | OK | OK | OK | OK | ![UNNEEDED, same version exists in internal repository UNNEEDED, same version exists in internal repository](../120px-Blue_Light_Icon.svg.png) |
R version 3.5.1 Patched (2018-07-12 r74967) -- "Feather Spray"
Copyright (C) 2018 The R Foundation for Statistical Computing
Platform: x86_64-pc-linux-gnu (64-bit)
R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.
R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.
Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.
> require(trena) || stop("unable to load trena Package")
Loading required package: trena
Loading required package: glmnet
Loading required package: Matrix
Loading required package: foreach
Loaded glmnet 2.0-16
Loading required package: MotifDb
Loading required package: BiocGenerics
Loading required package: parallel
Attaching package: 'BiocGenerics'
The following objects are masked from 'package:parallel':
clusterApply, clusterApplyLB, clusterCall, clusterEvalQ,
clusterExport, clusterMap, parApply, parCapply, parLapply,
parLapplyLB, parRapply, parSapply, parSapplyLB
The following objects are masked from 'package:Matrix':
colMeans, colSums, rowMeans, rowSums, which
The following objects are masked from 'package:stats':
IQR, mad, sd, var, xtabs
The following objects are masked from 'package:base':
Filter, Find, Map, Position, Reduce, anyDuplicated, append,
as.data.frame, basename, cbind, colMeans, colSums, colnames,
dirname, do.call, duplicated, eval, evalq, get, grep, grepl,
intersect, is.unsorted, lapply, lengths, mapply, match, mget,
order, paste, pmax, pmax.int, pmin, pmin.int, rank, rbind,
rowMeans, rowSums, rownames, sapply, setdiff, sort, table, tapply,
union, unique, unsplit, which, which.max, which.min
Loading required package: S4Vectors
Loading required package: stats4
Attaching package: 'S4Vectors'
The following object is masked from 'package:Matrix':
expand
The following object is masked from 'package:base':
expand.grid
Loading required package: IRanges
Loading required package: Biostrings
Loading required package: XVector
Attaching package: 'Biostrings'
The following object is masked from 'package:base':
strsplit
See system.file("LICENSE", package="MotifDb") for use restrictions.
[1] TRUE
> BiocGenerics:::testPackage('trena')
[1] --- test_BayesSpikeSolverConstructor
[1] --- test_ampAD.mef2c.154tfs.278samples.bayesSpike
[1] --- test_nOrderings
[1] --- test_BayesSpikeSolverConstructor
[1] --- test_ampAD.mef2c.154tfs.278samples.bayesSpike
[1] --- test_nOrderings
[1] --- test_CandidateFilter
[1] --- test_CandidateFilter
[1] --- test_EnsembleSolverConstructor
[1] --- test_ampAD.mef2c.154tfs.278samples.ensemble
[1] --- test_selectedSolversOnly
[1] --- test_pcaError
[1] --- test_getSolverNames
[1] --- test_oneSolver
[1] --- test_invalidSolvers
[1] --- test_EnsembleSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, targetGene = targetGene, candidateRegulators = candidateRegulators, :
Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.ensemble
[1] --- test_getSolverNames
[1] --- test_invalidSolvers
[1] --- test_oneSolver
[1] --- test_pcaError
[1] --- test_selectedSolversOnly
[1] --- test_FootprintFilter.byRegion
[1] --- test_FootprintFilter.byTwoRegions
[1] --- test_FootprintFilter.byRegion
[1] --- test_FootprintFilter.byTwoRegions
Loading required package: DBI
[1] --- test_parseDatabaseUri
[1] --- test_constructor
[1] --- test_getGtfGeneBioTypes
[1] --- test_getGtfMoleculeTypes
[1] --- test_getChromLoc
[1] --- test_getGenePromoterRegion
[1] --- test_getFootprintsInRegion
[1] --- test_getFootprintsInRegionWithVariants
[1] --- test_getFootprintsForGene
[1] --- test_constructor
[1] --- test_getChromLoc
[1] --- test_getFootprintsForGene
[1] --- test_getFootprintsInRegion
[1] --- test_getFootprintsInRegionWithVariants
[1] --- test_getGenePromoterRegion
[1] --- test_getGtfGeneBioTypes
[1] --- test_getGtfMoleculeTypes
[1] --- test_parseDatabaseUri
[1] --- test_directMode
Loading required package: org.Hs.eg.db
Loading required package: AnnotationDbi
Loading required package: Biobase
Welcome to Bioconductor
Vignettes contain introductory material; view with
'browseVignettes()'. To cite Bioconductor, see
'citation("Biobase")', and for packages 'citation("pkgname")'.
[1] --- test_directMode
[1] --- test_LassoPvSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene, :
Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.lassopv
[1] --- test_LassoPvSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene, :
Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.lassopv
[1] --- test_LassoSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene, :
Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_developAndFitDummyTestData
[1] --- test_fitDummyData
[1] --- test_ampAD.mef2c.154tfs.278samples.lasso
[1] --- test_alpha.lasso
Warning: call dbDisconnect() when finished working with a connection
[1] --- test_lambda.lasso
[1] --- test_keep.metrics.lasso
[1] --- test_scalePredictorPenalties.lasso
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene, :
Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_LassoSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene, :
Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_alpha.lasso
[1] --- test_ampAD.mef2c.154tfs.278samples.lasso
[1] --- test_developAndFitDummyTestData
[1] --- test_fitDummyData
[1] --- test_keep.metrics.lasso
[1] --- test_lambda.lasso
[1] --- test_scalePredictorPenalties.lasso
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene, :
Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_.getScoredMotifs
[1] --- test_.injectSnp
[1] --- test_basicConstructor
[1] --- test_bugInStartEndOfMinusStrandHits
[1] --- test_findMatchesByChromosomalRegion
[1] best$seq: ACCAGCATGCAAATTAGACAA
[1] --- test_findMatchesByChromosomalRegion.twoAlternateAlleles
[1] --- test_findMatchesByChromosomalRegion_contrastReferenceWithVariant
[1] --- test_findMatchesByMultipleChromosomalRegions
[1] --- test_getSequence
[1] --- test_getSequenceWithVariants
[1] --- test_noMatch
[1] --- test_PearsonSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene, :
Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.pearson
[1] --- test_PearsonSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene, :
Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.pearson
[1] --- test_RandomForestSolverConstructor
[1] --- test_RandomForestSolverFewCandidates
[1] --- test_ampAD.mef2c.154tfs.278samples.randomForest
[1] --- test_RandomForestSolverConstructor
[1] --- test_RandomForestSolverFewCandidates
[1] --- test_ampAD.mef2c.154tfs.278samples.randomForest
[1] --- test_RidgeSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene, :
Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.ridge
[1] --- test_alpha.ridge
[1] --- test_lambda.ridge
[1] --- test_keep.metrics.ridge
[1] --- test_RidgeSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene, :
Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_alpha.ridge
[1] --- test_ampAD.mef2c.154tfs.278samples.ridge
[1] --- test_keep.metrics.ridge
[1] --- test_lambda.ridge
[1] --- test_getAssayData
Warning in Solver(mtx, "gene1", c("gene2", "gene3")) :
Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_getTarget
[1] --- test_getRegulators
[1] --- test_eliminateSelfTFs
[1] --- test_MatrixWarnings
[1] --- test_TargetAndRegulatorWarnings
[1] --- test_MatrixWarnings
[1] --- test_TargetAndRegulatorWarnings
[1] --- test_eliminateSelfTFs
[1] --- test_getAssayData
[1] --- test_getRegulators
[1] --- test_getTarget
[1] --- test_SpearmanSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene, :
Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.spearman
[1] --- test_SpearmanSolverConstructor
Warning in Solver(mtx.assay = mtx.assay, quiet = quiet, targetGene = targetGene, :
Target gene mean expression is in the bottom 10% of all genes in the assay matrix
[1] --- test_ampAD.mef2c.154tfs.278samples.spearman
[1] --- test_SqrtLassoSolverConstructor
[1] --- test_ampAD.mef2c.154tfs.278samples.sqrtlasso
[1] --- test_lambda.sqrtlasso
[1] --- test_nCores.sqrtlasso
[1] --- test_SqrtLassoSolverConstructor
[1] --- test_ampAD.mef2c.154tfs.278samples.sqrtlasso
[1] --- test_lambda.sqrtlasso
[1] --- test_nCores.sqrtlasso
[1] --- test_basicConstructor
[1] --- test_getRegulatoryRegions_oneFootprintSource
[1] calling footprintFilter with source = 'sqlite:///home/biocbuild/bbs-3.7-bioc/R/library/trena/extdata/mef2c.neigborhood.hg38.footprints.db', span: 2001
[1] --- test_getRegulatoryRegions_encodeDHS
[1] calling HumanDHSFilter, span: 5
[1] calling HumanDHSFilter, span: 201
[1] --- test_getRegulatoryRegions_twoFootprintSources
[1] calling footprintFilter with source = 'sqlite:///home/biocbuild/bbs-3.7-bioc/R/library/trena/extdata/mef2c.neigborhood.hg38.footprints.db', span: 2001
[1] calling footprintFilter with source = 'sqlite:///home/biocbuild/bbs-3.7-bioc/R/library/trena/extdata/mef2c.neigborhood.hg38.footprints.db', span: 2001
[1] --- test_createGeneModel
[1] --- test_getProximalPromoterHuman
[1] --- test_getProximalPromoterMouse
[1] --- test_assessSnp
[1] error, unrecognized variant name: 'rsBogus'
[1] --- test_assessSnp_allTypesWithDeltas
[1] --- test_basicConstructor
[1] --- test_createGeneModel
[1] --- test_getProximalPromoterHuman
[1] --- test_getProximalPromoterMouse
[1] --- test_getRegulatoryRegions_encodeDHS
[1] calling HumanDHSFilter, span: 5
[1] calling HumanDHSFilter, span: 201
[1] --- test_getRegulatoryRegions_oneFootprintSource
[1] calling footprintFilter with source = 'sqlite:///home/biocbuild/bbs-3.7-bioc/R/library/trena/extdata/mef2c.neigborhood.hg38.footprints.db', span: 2001
[1] --- test_getRegulatoryRegions_twoFootprintSources
[1] calling footprintFilter with source = 'sqlite:///home/biocbuild/bbs-3.7-bioc/R/library/trena/extdata/mef2c.neigborhood.hg38.footprints.db', span: 2001
[1] calling footprintFilter with source = 'sqlite:///home/biocbuild/bbs-3.7-bioc/R/library/trena/extdata/mef2c.neigborhood.hg38.footprints.db', span: 2001
[1] --- test_VarianceFilter
[1] --- test_VarianceFilter
RUNIT TEST PROTOCOL -- Tue Oct 16 04:26:44 2018
***********************************************
Number of test functions: 85
Number of errors: 0
Number of failures: 0
1 Test Suite :
trena RUnit Tests - 85 test functions, 0 errors, 0 failures
Number of test functions: 85
Number of errors: 0
Number of failures: 0
Warning messages:
1: In Solver(mtx.assay = mtx.assay, targetGene = targetGene, candidateRegulators = candidateRegulators, :
Target gene mean expression is in the bottom 10% of all genes in the assay matrix
2: In Solver(mtx.assay = mtx.assay, targetGene = targetGene, candidateRegulators = candidateRegulators, :
Target gene mean expression is in the bottom 10% of all genes in the assay matrix
3: In Solver(mtx.assay = mtx.assay, targetGene = targetGene, candidateRegulators = candidateRegulators, :
Target gene mean expression is in the bottom 10% of all genes in the assay matrix
>
> proc.time()
user system elapsed
292.692 19.928 318.251