Back to Multiple platform build/check report for BioC 3.13 |
|
This page was generated on 2021-10-15 15:06:56 -0400 (Fri, 15 Oct 2021).
To the developers/maintainers of the tRNAdbImport package: - Please allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/tRNAdbImport.git to reflect on this report. See How and When does the builder pull? When will my changes propagate? here for more information. - Make sure to use the following settings in order to reproduce any error or warning you see on this page. |
Package 1966/2041 | Hostname | OS / Arch | INSTALL | BUILD | CHECK | BUILD BIN | ||||||||
tRNAdbImport 1.10.0 (landing page) Felix G.M. Ernst
| nebbiolo1 | Linux (Ubuntu 20.04.2 LTS) / x86_64 | OK | OK | OK | ![]() | ||||||||
tokay2 | Windows Server 2012 R2 Standard / x64 | OK | OK | OK | OK | ![]() | ||||||||
machv2 | macOS 10.14.6 Mojave / x86_64 | OK | OK | ERROR | OK | |||||||||
Package: tRNAdbImport |
Version: 1.10.0 |
Command: /Library/Frameworks/R.framework/Versions/Current/Resources/bin/R CMD check --install=check:tRNAdbImport.install-out.txt --library=/Library/Frameworks/R.framework/Versions/Current/Resources/library --no-vignettes --timings tRNAdbImport_1.10.0.tar.gz |
StartedAt: 2021-10-15 00:58:38 -0400 (Fri, 15 Oct 2021) |
EndedAt: 2021-10-15 01:01:18 -0400 (Fri, 15 Oct 2021) |
EllapsedTime: 160.2 seconds |
RetCode: 1 |
Status: ERROR |
CheckDir: tRNAdbImport.Rcheck |
Warnings: NA |
############################################################################## ############################################################################## ### ### Running command: ### ### /Library/Frameworks/R.framework/Versions/Current/Resources/bin/R CMD check --install=check:tRNAdbImport.install-out.txt --library=/Library/Frameworks/R.framework/Versions/Current/Resources/library --no-vignettes --timings tRNAdbImport_1.10.0.tar.gz ### ############################################################################## ############################################################################## * using log directory ‘/Users/biocbuild/bbs-3.13-bioc/meat/tRNAdbImport.Rcheck’ * using R version 4.1.1 (2021-08-10) * using platform: x86_64-apple-darwin17.0 (64-bit) * using session charset: UTF-8 * using option ‘--no-vignettes’ * checking for file ‘tRNAdbImport/DESCRIPTION’ ... OK * this is package ‘tRNAdbImport’ version ‘1.10.0’ * package encoding: UTF-8 * checking package namespace information ... OK * checking package dependencies ... OK * checking if this is a source package ... OK * checking if there is a namespace ... OK * checking for hidden files and directories ... NOTE Found the following hidden files and directories: .git_fetch_output.txt .git_merge_output.txt These were most likely included in error. See section ‘Package structure’ in the ‘Writing R Extensions’ manual. * checking for portable file names ... OK * checking for sufficient/correct file permissions ... OK * checking whether package ‘tRNAdbImport’ can be installed ... OK * checking installed package size ... OK * checking package directory ... OK * checking ‘build’ directory ... OK * checking DESCRIPTION meta-information ... OK * checking top-level files ... OK * checking for left-over files ... OK * checking index information ... OK * checking package subdirectories ... OK * checking R files for non-ASCII characters ... OK * checking R files for syntax errors ... OK * checking whether the package can be loaded ... OK * checking whether the package can be loaded with stated dependencies ... OK * checking whether the package can be unloaded cleanly ... OK * checking whether the namespace can be loaded with stated dependencies ... OK * checking whether the namespace can be unloaded cleanly ... OK * checking dependencies in R code ... NOTE Namespace in Imports field not imported from: ‘BiocGenerics’ All declared Imports should be used. * checking S3 generic/method consistency ... OK * checking replacement functions ... OK * checking foreign function calls ... OK * checking R code for possible problems ... OK * checking Rd files ... OK * checking Rd metadata ... OK * checking Rd cross-references ... OK * checking for missing documentation entries ... OK * checking for code/documentation mismatches ... OK * checking Rd \usage sections ... OK * checking Rd contents ... OK * checking for unstated dependencies in examples ... OK * checking files in ‘vignettes’ ... OK * checking examples ... ERROR Running examples in ‘tRNAdbImport-Ex.R’ failed The error most likely occurred in: > base::assign(".ptime", proc.time(), pos = "CheckExEnv") > ### Name: import.tRNAdb > ### Title: Importing information from the tRNA db as GRanges object > ### Aliases: import.tRNAdb import.mttRNAdb import.tRNAdb.id > ### import.mttRNAdb.id import.tRNAdb.blast import.mttRNAdb.blast > ### tRNAdb2GFF TRNA_DB_URL TRNA_DB_URL_MT > ### Keywords: datasets > > ### ** Examples > > import.tRNAdb(organism = "Saccharomyces cerevisiae", + aminoacids = c("Phe","Ala")) GRanges object with 13 ranges and 15 metadata columns: seqnames ranges strand | no tRNA_length tRNA_type <Rle> <IRanges> <Rle> | <integer> <integer> <character> [1] tdbD00000218 1-73 * | 1 73 Ala [2] tdbD00000219 1-73 * | 2 73 Ala [3] tdbD00000785 1-73 * | 3 73 Phe [4] tdbD00000786 1-73 * | 4 73 Phe [5] tdbD00000787 1-73 * | 5 73 Phe ... ... ... ... . ... ... ... [9] tdbD00005005 1-73 * | 9 73 Phe [10] tdbD00005006 1-73 * | 10 73 Phe [11] tdbD00005007 1-73 * | 11 73 Phe [12] tdbD00005008 1-73 * | 12 73 Phe [13] tdbD00005009 1-73 * | 13 73 Phe tRNA_anticodon tRNA_seq tRNA_str <character> <DNAStringSet> <DotBracketStringSet> [1] TGC GGGCACATGG...GTTGCGTCCA <<<<.<<..<...>>>>.>>>>. [2] AGC GGGCGTGTGG...GACTCGTCCA <<<<<.<..<...>>>.>>>>>. [3] GAA GCGGATTTAG...AGAATTCGCA <<<<<<<..<...>>>>>>>>>. [4] GAA GCGGATTTAG...AGAGTTCGCA <<<<<<<..<...>>>>>>>>>. [5] GAA GCGGATTTAG...AGAATTCGCA <<<<<<<..<...>>>>>>>>>. ... ... ... ... [9] GAA GCGGACTTAG...AGAGTTCGCA <<<<<<<..<...>>>>>>>>>. [10] GAA GCGGATTTAG...AGAATTCGCA <<<<<<<..<...>>>>>>>>>. [11] GAA GCGGATTTAG...AGAATTCGCA <<<<<<<..<...>>>>>>>>>. [12] GAA GCGGATTTAG...AGAATTCGCA <<<<<<<..<...>>>>>>>>>. [13] GAA GCGGACTTAG...AGAGTTCGCA <<<<<<<..<...>>>>>>>>>. tRNA_CCA.end tRNAdb tRNAdb_ID tRNAdb_organism <logical> <character> <character> <character> [1] FALSE DNA tdbD00000218 Saccharomyces cerevi.. [2] FALSE DNA tdbD00000219 Saccharomyces cerevi.. [3] FALSE DNA tdbD00000785 Saccharomyces cerevi.. [4] FALSE DNA tdbD00000786 Saccharomyces cerevi.. [5] FALSE DNA tdbD00000787 Saccharomyces cerevi.. ... ... ... ... ... [9] FALSE DNA tdbD00005005 Saccharomyces cerevi.. [10] FALSE DNA tdbD00005006 Saccharomyces cerevi.. [11] FALSE DNA tdbD00005007 Saccharomyces cerevi.. [12] FALSE DNA tdbD00005008 Saccharomyces cerevi.. [13] FALSE DNA tdbD00005009 Saccharomyces cerevi.. tRNAdb_strain tRNAdb_taxonomyID tRNAdb_verified tRNAdb_reference <character> <character> <logical> <CharacterList> [1] 4932 FALSE H.J.DRABKIN, U.L.RAJ.. [2] 4932 FALSE F.CREUSOT, M.GAISNE,.. [3] 4932 FALSE P.VALENZUELA, A.VENE.. [4] 4932 FALSE P.BULL ET AL. (1987).. [5] 4932 FALSE A.GOFFEAU ET AL. (19.. ... ... ... ... ... [9] unk 4932 FALSE Lowe, T.M. & Eddy, S.. [10] unk 4932 FALSE Lowe, T.M. & Eddy, S.. [11] unk 4932 FALSE Lowe, T.M. & Eddy, S.. [12] unk 4932 FALSE Lowe, T.M. & Eddy, S.. [13] unk 4932 FALSE Lowe, T.M. & Eddy, S.. tRNAdb_pmid <CharacterList> [1] [2] [3] [4] [5] ... ... [9] 9023104 [10] 9023104 [11] 9023104 [12] 9023104 [13] 9023104 ------- seqinfo: 13 sequences from an unspecified genome; no seqlengths > import.tRNAdb.id(tdbID = "tdbD00000785") GRanges object with 1 range and 15 metadata columns: seqnames ranges strand | no tRNA_length tRNA_type <Rle> <IRanges> <Rle> | <integer> <integer> <character> [1] tdbD00000785 1-73 * | 1 73 Phe tRNA_anticodon tRNA_seq tRNA_str <character> <DNAStringSet> <DotBracketStringSet> [1] GAA GCGGATTTAG...AGAATTCGCA <<<<<<<..<...>>>>>>>>>. tRNA_CCA.end tRNAdb tRNAdb_ID tRNAdb_organism <logical> <character> <character> <character> [1] FALSE DNA tdbD00000785 Saccharomyces cerevi.. tRNAdb_strain tRNAdb_taxonomyID tRNAdb_verified tRNAdb_reference <character> <character> <logical> <CharacterList> [1] 4932 FALSE P.VALENZUELA, A.VENE.. tRNAdb_pmid <CharacterList> [1] ------- seqinfo: 1 sequence from an unspecified genome; no seqlengths > import.tRNAdb.blast(blastSeq = + "GCGGATTTAGCTCAGTTGGGAGAGCGCCAGACTGAAGATCTGGAGGTCCTGTGTTCGATCCACAGAATTCGCA") Error in curl::curl_fetch_memory(url, handle = handle) : transfer closed with outstanding read data remaining Calls: import.tRNAdb.blast ... request_fetch -> request_fetch.write_memory -> <Anonymous> Execution halted * checking for unstated dependencies in ‘tests’ ... OK * checking tests ... Running ‘testthat.R’ OK * checking for unstated dependencies in vignettes ... OK * checking package vignettes in ‘inst/doc’ ... OK * checking running R code from vignettes ... SKIPPED * checking re-building of vignette outputs ... SKIPPED * checking PDF version of manual ... OK * DONE Status: 1 ERROR, 2 NOTEs See ‘/Users/biocbuild/bbs-3.13-bioc/meat/tRNAdbImport.Rcheck/00check.log’ for details.
tRNAdbImport.Rcheck/00install.out
############################################################################## ############################################################################## ### ### Running command: ### ### /Library/Frameworks/R.framework/Versions/Current/Resources/bin/R CMD INSTALL tRNAdbImport ### ############################################################################## ############################################################################## * installing to library ‘/Library/Frameworks/R.framework/Versions/4.1/Resources/library’ * installing *source* package ‘tRNAdbImport’ ... ** using staged installation ** R ** byte-compile and prepare package for lazy loading ** help *** installing help indices ** building package indices ** installing vignettes ** testing if installed package can be loaded from temporary location ** testing if installed package can be loaded from final location ** testing if installed package keeps a record of temporary installation path * DONE (tRNAdbImport)
tRNAdbImport.Rcheck/tests/testthat.Rout
R version 4.1.1 (2021-08-10) -- "Kick Things" Copyright (C) 2021 The R Foundation for Statistical Computing Platform: x86_64-apple-darwin17.0 (64-bit) R is free software and comes with ABSOLUTELY NO WARRANTY. You are welcome to redistribute it under certain conditions. Type 'license()' or 'licence()' for distribution details. R is a collaborative project with many contributors. Type 'contributors()' for more information and 'citation()' on how to cite R or R packages in publications. Type 'demo()' for some demos, 'help()' for on-line help, or 'help.start()' for an HTML browser interface to help. Type 'q()' to quit R. > library(testthat) > library(httptest) > library(tRNAdbImport) Loading required package: GenomicRanges Loading required package: stats4 Loading required package: BiocGenerics Loading required package: parallel Attaching package: 'BiocGenerics' The following objects are masked from 'package:parallel': clusterApply, clusterApplyLB, clusterCall, clusterEvalQ, clusterExport, clusterMap, parApply, parCapply, parLapply, parLapplyLB, parRapply, parSapply, parSapplyLB The following objects are masked from 'package:stats': IQR, mad, sd, var, xtabs The following objects are masked from 'package:base': Filter, Find, Map, Position, Reduce, anyDuplicated, append, as.data.frame, basename, cbind, colnames, dirname, do.call, duplicated, eval, evalq, get, grep, grepl, intersect, is.unsorted, lapply, mapply, match, mget, order, paste, pmax, pmax.int, pmin, pmin.int, rank, rbind, rownames, sapply, setdiff, sort, table, tapply, union, unique, unsplit, which.max, which.min Loading required package: S4Vectors Attaching package: 'S4Vectors' The following objects are masked from 'package:base': I, expand.grid, unname Loading required package: IRanges Loading required package: GenomeInfoDb Loading required package: Modstrings Loading required package: Biostrings Loading required package: XVector Attaching package: 'Biostrings' The following object is masked from 'package:base': strsplit Loading required package: Structstrings Loading required package: tRNA > > test_check("tRNAdbImport") ══ Skipped tests ═══════════════════════════════════════════════════════════════ • On CRAN (1) [ FAIL 0 | WARN 0 | SKIP 1 | PASS 15 ] > > proc.time() user system elapsed 6.524 0.378 7.242
tRNAdbImport.Rcheck/tRNAdbImport-Ex.timings
name | user | system | elapsed |