Back to Multiple platform build/check report for BioC 3.18:   simplified   long
ABCDE[F]GHIJKLMNOPQRSTUVWXYZ

This page was generated on 2024-03-18 11:35:55 -0400 (Mon, 18 Mar 2024).

HostnameOSArch (*)R versionInstalled pkgs
nebbiolo2Linux (Ubuntu 22.04.3 LTS)x86_644.3.3 (2024-02-29) -- "Angel Food Cake" 4665
palomino4Windows Server 2022 Datacenterx644.3.3 (2024-02-29 ucrt) -- "Angel Food Cake" 4401
merida1macOS 12.7.1 Montereyx86_644.3.3 (2024-02-29) -- "Angel Food Cake" 4425
Click on any hostname to see more info about the system (e.g. compilers)      (*) as reported by 'uname -p', except on Windows and Mac OS X

Package 716/2266HostnameOS / ArchINSTALLBUILDCHECKBUILD BIN
FLAMES 1.8.0  (landing page)
Oliver Voogd
Snapshot Date: 2024-03-15 14:05:07 -0400 (Fri, 15 Mar 2024)
git_url: https://git.bioconductor.org/packages/FLAMES
git_branch: RELEASE_3_18
git_last_commit: 8b72098
git_last_commit_date: 2023-10-24 11:34:56 -0400 (Tue, 24 Oct 2023)
nebbiolo2Linux (Ubuntu 22.04.3 LTS) / x86_64  OK    OK    OK  UNNEEDED, same version is already published
palomino4Windows Server 2022 Datacenter / x64... NOT SUPPORTED ...
merida1macOS 12.7.1 Monterey / x86_64  OK    OK    OK    OK  UNNEEDED, same version is already published
kjohnson1macOS 13.6.1 Ventura / arm64see weekly results here

CHECK results for FLAMES on nebbiolo2


To the developers/maintainers of the FLAMES package:
- Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/FLAMES.git to reflect on this report. See Troubleshooting Build Report for more information.
- Use the following Renviron settings to reproduce errors and warnings.
- If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information.

raw results


Summary

Package: FLAMES
Version: 1.8.0
Command: /home/biocbuild/bbs-3.18-bioc/R/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/home/biocbuild/bbs-3.18-bioc/R/site-library --timings FLAMES_1.8.0.tar.gz
StartedAt: 2024-03-15 22:20:44 -0400 (Fri, 15 Mar 2024)
EndedAt: 2024-03-15 22:30:41 -0400 (Fri, 15 Mar 2024)
EllapsedTime: 596.8 seconds
RetCode: 0
Status:   OK  
CheckDir: FLAMES.Rcheck
Warnings: 0

Command output

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/bbs-3.18-bioc/R/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/home/biocbuild/bbs-3.18-bioc/R/site-library --timings FLAMES_1.8.0.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/home/biocbuild/bbs-3.18-bioc/meat/FLAMES.Rcheck’
* using R version 4.3.3 (2024-02-29)
* using platform: x86_64-pc-linux-gnu (64-bit)
* R was compiled by
    gcc (Ubuntu 11.4.0-1ubuntu1~22.04) 11.4.0
    GNU Fortran (Ubuntu 11.4.0-1ubuntu1~22.04) 11.4.0
* running under: Ubuntu 22.04.4 LTS
* using session charset: UTF-8
* checking for file ‘FLAMES/DESCRIPTION’ ... OK
* checking extension type ... Package
* this is package ‘FLAMES’ version ‘1.8.0’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... NOTE
Found the following hidden files and directories:
  .BBSoptions
These were most likely included in error. See section ‘Package
structure’ in the ‘Writing R Extensions’ manual.
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘FLAMES’ can be installed ... NOTE
Found the following notes/warnings:
  Non-staged installation was used
See ‘/home/biocbuild/bbs-3.18-bioc/meat/FLAMES.Rcheck/00install.out’ for details.
* used C++ compiler: ‘g++ (Ubuntu 11.4.0-1ubuntu1~22.04) 11.4.0’
* checking C++ specification ... OK
  Not all R platforms support C++17
* checking installed package size ... OK
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... OK
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking R files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... NOTE
annotation_to_fasta: no visible global function definition for
  'write.table'
generate_sc_sce: no visible binding for global variable 'FSM_match'
plot_coverage: no visible binding for global variable 'x'
plot_coverage: no visible binding for global variable 'transcript'
plot_coverage: no visible binding for global variable 'length_bin'
plot_demultiplex: no visible binding for global variable 'Freq'
plot_demultiplex: no visible binding for global variable '.'
plot_demultiplex: no visible binding for global variable 'x'
plot_demultiplex: no visible binding for global variable
  'FlankEditDist'
plot_demultiplex: no visible binding for global variable 'n'
plot_demultiplex: no visible binding for global variable
  'BarcodeEditDist'
plot_flagstat: no visible global function definition for 'everything'
plot_flagstat: no visible binding for global variable 'name'
plot_flagstat: no visible binding for global variable 'value'
sc_DTU_analysis: no visible binding for global variable 'FSM_match'
sc_DTU_analysis: no visible binding for global variable 'gene_id'
sc_DTU_analysis: no visible binding for global variable '.'
sc_DTU_analysis: no visible binding for global variable 'cell_id'
sc_DTU_analysis: no visible binding for global variable 'cnt'
sc_DTU_analysis: no visible binding for global variable 'tr_id'
sc_DTU_analysis: no visible binding for global variable 'label'
sc_DTU_analysis : filter_tr: no visible binding for global variable
  'gene_id'
sc_DTU_analysis : filter_tr: no visible global function definition for
  'all_vars'
sc_DTU_analysis : filter_tr: no visible binding for global variable '.'
sc_DTU_analysis: no visible global function definition for 'all_vars'
sc_heatmap_expression: no visible binding for global variable
  'transcript_id'
sc_heatmap_expression: no visible binding for global variable 'gene_id'
sc_heatmap_expression : group_annotation: no visible binding for global
  variable 'heatmap_annotation_colors'
sc_umap_expression: no visible binding for global variable
  'transcript_id'
sc_umap_expression: no visible binding for global variable 'gene_id'
sc_umap_expression: no visible binding for global variable 'x'
sc_umap_expression: no visible binding for global variable 'y'
sc_umap_expression : plot_idx: no visible binding for global variable
  'x'
sc_umap_expression : plot_idx: no visible binding for global variable
  'y'
transcript_coverage: no visible binding for global variable 'mat'
Undefined global functions or variables:
  . BarcodeEditDist FSM_match FlankEditDist Freq all_vars cell_id cnt
  everything gene_id heatmap_annotation_colors label length_bin mat n
  name tr_id transcript transcript_id value write.table x y
Consider adding
  importFrom("utils", "write.table")
to your NAMESPACE file.
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... OK
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking LazyData ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking line endings in shell scripts ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking line endings in Makefiles ... OK
* checking compilation flags in Makevars ... OK
* checking for GNU extensions in Makefiles ... NOTE
GNU make is a SystemRequirements.
* checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK
* checking use of PKG_*FLAGS in Makefiles ... OK
* checking compiled code ... NOTE
Note: information on .o files is not available
* checking files in ‘vignettes’ ... OK
* checking examples ... OK
Examples with CPU (user + system) or elapsed time > 5s
                        user system elapsed
sc_heatmap_expression 35.113  2.361  36.174
sc_umap_expression    29.863  0.729  29.278
sc_reduce_dims        17.907  0.692  17.293
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘testthat.R’
 OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes in ‘inst/doc’ ... OK
* checking running R code from vignettes ...
  ‘FLAMES_vignette.Rmd’ using ‘UTF-8’... OK
 NONE
* checking re-building of vignette outputs ... OK
* checking PDF version of manual ... OK
* DONE

Status: 5 NOTEs
See
  ‘/home/biocbuild/bbs-3.18-bioc/meat/FLAMES.Rcheck/00check.log’
for details.



Installation output

FLAMES.Rcheck/00install.out

##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/bbs-3.18-bioc/R/bin/R CMD INSTALL FLAMES
###
##############################################################################
##############################################################################


* installing to library ‘/home/biocbuild/bbs-3.18-bioc/R/site-library’
* installing *source* package ‘FLAMES’ ...
** using non-staged installation via StagedInstall field
** libs
using C++ compiler: ‘g++ (Ubuntu 11.4.0-1ubuntu1~22.04) 11.4.0’
using C++17
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.18-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.18-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.18-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.18-bioc/R/site-library/zlibbioc/include' -I/usr/local/include    -fpic  -g -O2  -Wall -c RcppExports.cpp -o RcppExports.o
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.18-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.18-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.18-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.18-bioc/R/site-library/zlibbioc/include' -I/usr/local/include    -fpic  -g -O2  -Wall -c flexiplex.cpp -o flexiplex.o
flexiplex.cpp: In function ‘unsigned int edit_distance(const string&, const string&, unsigned int&, int)’:
flexiplex.cpp:118:21: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
  118 |       if (min_value <= max_editd)
      |           ~~~~~~~~~~^~~~~~~~~~~~
flexiplex.cpp: In function ‘Barcode get_barcode(const string&, const std::unordered_set<std::__cxx11::basic_string<char> >&, int, int, const std::vector<std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > >&)’:
flexiplex.cpp:224:19: warning: comparison of integer expressions of different signedness: ‘int’ and ‘__gnu_cxx::__alloc_traits<std::allocator<long unsigned int>, long unsigned int>::value_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  224 |     if (i_pattern >= subpattern_ends[i_subpattern]) {
flexiplex.cpp:285:22: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
  285 |     if (editDistance == barcode.editd) {
      |         ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~
flexiplex.cpp:287:29: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
  287 |     } else if (editDistance < barcode.editd &&
      |                ~~~~~~~~~~~~~^~~~~~~~~~~~~~~
flexiplex.cpp:288:29: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare]
  288 |                editDistance <= barcode_max_editd) { // if best so far, update
      |                ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
flexiplex.cpp: In function ‘std::vector<Barcode> big_barcode_search(const string&, const std::unordered_set<std::__cxx11::basic_string<char> >&, int, int, const std::vector<std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > >&)’:
flexiplex.cpp:350:29: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const size_type’ {aka ‘const long unsigned int’} [-Wsign-compare]
  350 |       if (barcode.flank_end == std::string::npos) {
      |           ~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
flexiplex.cpp: In function ‘void print_stats(const string&, const std::vector<Barcode>&, std::ostream&)’:
flexiplex.cpp:375:38: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const size_type’ {aka ‘const long unsigned int’} [-Wsign-compare]
  375 |                << (barcode.flank_end == std::string::npos ? "True" : "False")
      |                    ~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
flexiplex.cpp: In function ‘void print_read(const string&, const string&, const string&, const std::vector<Barcode>&, std::ofstream&, std::unordered_set<std::__cxx11::basic_string<char> >&, bool)’:
flexiplex.cpp:400:21: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  400 |   for (int b = 0; b < vec_bc.size(); b++) {
      |                   ~~^~~~~~~~~~~~~~~
flexiplex.cpp:410:32: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const size_type’ {aka ‘const long unsigned int’} [-Wsign-compare]
  410 |     if (vec_bc.at(b).flank_end == std::string::npos) {
      |         ~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~
flexiplex.cpp:415:23: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  415 |     for (int f = 0; f < vec_bc.size(); f++) {
      |                     ~~^~~~~~~~~~~~~~~
flexiplex.cpp: In function ‘int flexiplex(Rcpp::String, Rcpp::String, bool, int, int, Rcpp::StringVector, Rcpp::String, Rcpp::String, Rcpp::String, int)’:
flexiplex.cpp:634:23: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<std::vector<SearchResult> >::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  634 |     for (int t = 0; t < sr_v.size();
      |                     ~~^~~~~~~~~~~~~
flexiplex.cpp:639:25: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<SearchResult>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  639 |       for (int r = 0; r < sr_v[t].size(); r++) { // loop over the reads
      |                       ~~^~~~~~~~~~~~~~~~
flexiplex.cpp:641:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  641 |         for (int b = 0; b < sr_v[t][r].vec_bc_for.size(); b++)
      |                         ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
flexiplex.cpp:643:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare]
  643 |         for (int b = 0; b < sr_v[t][r].vec_bc_rev.size(); b++)
      |                         ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.18-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.18-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.18-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.18-bioc/R/site-library/zlibbioc/include' -I/usr/local/include    -fpic  -g -O2  -Wall -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o
g++ -std=gnu++17 -shared -L/home/biocbuild/bbs-3.18-bioc/R/lib -L/usr/local/lib -o FLAMES.so RcppExports.o flexiplex.o utility/edlib-1.2.7/edlib.o -pthread /home/biocbuild/bbs-3.18-bioc/R/site-library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -L/home/biocbuild/bbs-3.18-bioc/R/lib -lR
if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi
installing to /home/biocbuild/bbs-3.18-bioc/R/site-library/FLAMES/libs
** R
** data
*** moving datasets to lazyload DB
** inst
** byte-compile and prepare package for lazy loading
** help
*** installing help indices
** building package indices
** installing vignettes
** testing if installed package can be loaded
* DONE (FLAMES)

Tests output

FLAMES.Rcheck/tests/testthat.Rout


R version 4.3.3 (2024-02-29) -- "Angel Food Cake"
Copyright (C) 2024 The R Foundation for Statistical Computing
Platform: x86_64-pc-linux-gnu (64-bit)

R is free software and comes with ABSOLUTELY NO WARRANTY.
You are welcome to redistribute it under certain conditions.
Type 'license()' or 'licence()' for distribution details.

R is a collaborative project with many contributors.
Type 'contributors()' for more information and
'citation()' on how to cite R or R packages in publications.

Type 'demo()' for some demos, 'help()' for on-line help, or
'help.start()' for an HTML browser interface to help.
Type 'q()' to quit R.

> library(testthat)
> library(FLAMES)
> 
> test_check("FLAMES")
Writing configuration parameters to:  /tmp/RtmpAjGZlV/file2f79526db711ff/config_file_3111250.json 
FLEXIPLEX 0.96.2
Setting max barcode edit distance to 2
Setting max flanking sequence edit distance to 8
Setting read IDs to be  replaced
Setting number of threads to 1
Search pattern: 
primer: CTACACGACGCTCTTCCGATCT
BC: NNNNNNNNNNNNNNNN
UMI: NNNNNNNNNNNN
polyT: TTTTTTTTT
Setting known barcodes from /tmp/RtmpAjGZlV/bc_allow.tsv
Number of known barcodes: 143
Searching for barcodes...
Number of reads processed: 393
Number of reads where a barcode was found: 368
Number of reads where more than one barcode was found: 4
All done!
Skipping TSO trimming...
[ FAIL 0 | WARN 0 | SKIP 0 | PASS 4 ]
> 
> proc.time()
   user  system elapsed 
 22.450   1.824  24.265 

Example timings

FLAMES.Rcheck/FLAMES-Ex.timings

nameusersystemelapsed
annotation_to_fasta1.1750.0951.272
blaze0.4480.0712.155
bulk_long_pipeline0.6470.0881.343
combine_sce1.4410.2401.681
create_config0.0030.0040.007
create_sce_from_dir0.1320.0040.135
create_se_from_dir0.7090.0281.249
cutadapt000
filter_annotation0.7280.0800.808
find_barcode0.1090.0080.118
find_isoform0.5060.0450.947
get_GRangesList0.6130.0581.101
locate_minimap2_dir0.0010.0010.001
minimap2_align0.6840.0401.161
minimap2_realign1.2530.1321.837
parse_gff_tree0.500.020.54
plot_coverage1.6920.1202.340
plot_demultiplex0.5620.1000.663
quantify_transcript2.0830.2632.849
sc_DTU_analysis1.6790.4762.154
sc_heatmap_expression35.113 2.36136.174
sc_long_multisample_pipeline1.0060.0281.034
sc_long_pipeline0.1120.0040.117
sc_mutations0.1150.0000.115
sc_reduce_dims17.907 0.69217.293
sc_umap_expression29.863 0.72929.278