Back to Multiple platform build/check report for BioC 3.18: simplified long |
|
This page was generated on 2024-03-18 11:35:55 -0400 (Mon, 18 Mar 2024).
Hostname | OS | Arch (*) | R version | Installed pkgs |
---|---|---|---|---|
nebbiolo2 | Linux (Ubuntu 22.04.3 LTS) | x86_64 | 4.3.3 (2024-02-29) -- "Angel Food Cake" | 4665 |
palomino4 | Windows Server 2022 Datacenter | x64 | 4.3.3 (2024-02-29 ucrt) -- "Angel Food Cake" | 4401 |
merida1 | macOS 12.7.1 Monterey | x86_64 | 4.3.3 (2024-02-29) -- "Angel Food Cake" | 4425 |
Click on any hostname to see more info about the system (e.g. compilers) (*) as reported by 'uname -p', except on Windows and Mac OS X |
Package 716/2266 | Hostname | OS / Arch | INSTALL | BUILD | CHECK | BUILD BIN | ||||||||
FLAMES 1.8.0 (landing page) Oliver Voogd
| nebbiolo2 | Linux (Ubuntu 22.04.3 LTS) / x86_64 | OK | OK | OK | |||||||||
palomino4 | Windows Server 2022 Datacenter / x64 | ... NOT SUPPORTED ... | ||||||||||||
merida1 | macOS 12.7.1 Monterey / x86_64 | OK | OK | OK | OK | |||||||||
kjohnson1 | macOS 13.6.1 Ventura / arm64 | see weekly results here | ||||||||||||
To the developers/maintainers of the FLAMES package: - Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/FLAMES.git to reflect on this report. See Troubleshooting Build Report for more information. - Use the following Renviron settings to reproduce errors and warnings. - If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information. |
Package: FLAMES |
Version: 1.8.0 |
Command: /home/biocbuild/bbs-3.18-bioc/R/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/home/biocbuild/bbs-3.18-bioc/R/site-library --timings FLAMES_1.8.0.tar.gz |
StartedAt: 2024-03-15 22:20:44 -0400 (Fri, 15 Mar 2024) |
EndedAt: 2024-03-15 22:30:41 -0400 (Fri, 15 Mar 2024) |
EllapsedTime: 596.8 seconds |
RetCode: 0 |
Status: OK |
CheckDir: FLAMES.Rcheck |
Warnings: 0 |
############################################################################## ############################################################################## ### ### Running command: ### ### /home/biocbuild/bbs-3.18-bioc/R/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/home/biocbuild/bbs-3.18-bioc/R/site-library --timings FLAMES_1.8.0.tar.gz ### ############################################################################## ############################################################################## * using log directory ‘/home/biocbuild/bbs-3.18-bioc/meat/FLAMES.Rcheck’ * using R version 4.3.3 (2024-02-29) * using platform: x86_64-pc-linux-gnu (64-bit) * R was compiled by gcc (Ubuntu 11.4.0-1ubuntu1~22.04) 11.4.0 GNU Fortran (Ubuntu 11.4.0-1ubuntu1~22.04) 11.4.0 * running under: Ubuntu 22.04.4 LTS * using session charset: UTF-8 * checking for file ‘FLAMES/DESCRIPTION’ ... OK * checking extension type ... Package * this is package ‘FLAMES’ version ‘1.8.0’ * package encoding: UTF-8 * checking package namespace information ... OK * checking package dependencies ... OK * checking if this is a source package ... OK * checking if there is a namespace ... OK * checking for hidden files and directories ... NOTE Found the following hidden files and directories: .BBSoptions These were most likely included in error. See section ‘Package structure’ in the ‘Writing R Extensions’ manual. * checking for portable file names ... OK * checking for sufficient/correct file permissions ... OK * checking whether package ‘FLAMES’ can be installed ... NOTE Found the following notes/warnings: Non-staged installation was used See ‘/home/biocbuild/bbs-3.18-bioc/meat/FLAMES.Rcheck/00install.out’ for details. * used C++ compiler: ‘g++ (Ubuntu 11.4.0-1ubuntu1~22.04) 11.4.0’ * checking C++ specification ... OK Not all R platforms support C++17 * checking installed package size ... OK * checking package directory ... OK * checking ‘build’ directory ... OK * checking DESCRIPTION meta-information ... OK * checking top-level files ... OK * checking for left-over files ... OK * checking index information ... OK * checking package subdirectories ... OK * checking R files for non-ASCII characters ... OK * checking R files for syntax errors ... OK * checking whether the package can be loaded ... OK * checking whether the package can be loaded with stated dependencies ... OK * checking whether the package can be unloaded cleanly ... OK * checking whether the namespace can be loaded with stated dependencies ... OK * checking whether the namespace can be unloaded cleanly ... OK * checking loading without being on the library search path ... OK * checking dependencies in R code ... OK * checking S3 generic/method consistency ... OK * checking replacement functions ... OK * checking foreign function calls ... OK * checking R code for possible problems ... NOTE annotation_to_fasta: no visible global function definition for 'write.table' generate_sc_sce: no visible binding for global variable 'FSM_match' plot_coverage: no visible binding for global variable 'x' plot_coverage: no visible binding for global variable 'transcript' plot_coverage: no visible binding for global variable 'length_bin' plot_demultiplex: no visible binding for global variable 'Freq' plot_demultiplex: no visible binding for global variable '.' plot_demultiplex: no visible binding for global variable 'x' plot_demultiplex: no visible binding for global variable 'FlankEditDist' plot_demultiplex: no visible binding for global variable 'n' plot_demultiplex: no visible binding for global variable 'BarcodeEditDist' plot_flagstat: no visible global function definition for 'everything' plot_flagstat: no visible binding for global variable 'name' plot_flagstat: no visible binding for global variable 'value' sc_DTU_analysis: no visible binding for global variable 'FSM_match' sc_DTU_analysis: no visible binding for global variable 'gene_id' sc_DTU_analysis: no visible binding for global variable '.' sc_DTU_analysis: no visible binding for global variable 'cell_id' sc_DTU_analysis: no visible binding for global variable 'cnt' sc_DTU_analysis: no visible binding for global variable 'tr_id' sc_DTU_analysis: no visible binding for global variable 'label' sc_DTU_analysis : filter_tr: no visible binding for global variable 'gene_id' sc_DTU_analysis : filter_tr: no visible global function definition for 'all_vars' sc_DTU_analysis : filter_tr: no visible binding for global variable '.' sc_DTU_analysis: no visible global function definition for 'all_vars' sc_heatmap_expression: no visible binding for global variable 'transcript_id' sc_heatmap_expression: no visible binding for global variable 'gene_id' sc_heatmap_expression : group_annotation: no visible binding for global variable 'heatmap_annotation_colors' sc_umap_expression: no visible binding for global variable 'transcript_id' sc_umap_expression: no visible binding for global variable 'gene_id' sc_umap_expression: no visible binding for global variable 'x' sc_umap_expression: no visible binding for global variable 'y' sc_umap_expression : plot_idx: no visible binding for global variable 'x' sc_umap_expression : plot_idx: no visible binding for global variable 'y' transcript_coverage: no visible binding for global variable 'mat' Undefined global functions or variables: . BarcodeEditDist FSM_match FlankEditDist Freq all_vars cell_id cnt everything gene_id heatmap_annotation_colors label length_bin mat n name tr_id transcript transcript_id value write.table x y Consider adding importFrom("utils", "write.table") to your NAMESPACE file. * checking Rd files ... OK * checking Rd metadata ... OK * checking Rd cross-references ... OK * checking for missing documentation entries ... OK * checking for code/documentation mismatches ... OK * checking Rd \usage sections ... OK * checking Rd contents ... OK * checking for unstated dependencies in examples ... OK * checking contents of ‘data’ directory ... OK * checking data for non-ASCII characters ... OK * checking LazyData ... OK * checking data for ASCII and uncompressed saves ... OK * checking line endings in shell scripts ... OK * checking line endings in C/C++/Fortran sources/headers ... OK * checking line endings in Makefiles ... OK * checking compilation flags in Makevars ... OK * checking for GNU extensions in Makefiles ... NOTE GNU make is a SystemRequirements. * checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK * checking use of PKG_*FLAGS in Makefiles ... OK * checking compiled code ... NOTE Note: information on .o files is not available * checking files in ‘vignettes’ ... OK * checking examples ... OK Examples with CPU (user + system) or elapsed time > 5s user system elapsed sc_heatmap_expression 35.113 2.361 36.174 sc_umap_expression 29.863 0.729 29.278 sc_reduce_dims 17.907 0.692 17.293 * checking for unstated dependencies in ‘tests’ ... OK * checking tests ... Running ‘testthat.R’ OK * checking for unstated dependencies in vignettes ... OK * checking package vignettes in ‘inst/doc’ ... OK * checking running R code from vignettes ... ‘FLAMES_vignette.Rmd’ using ‘UTF-8’... OK NONE * checking re-building of vignette outputs ... OK * checking PDF version of manual ... OK * DONE Status: 5 NOTEs See ‘/home/biocbuild/bbs-3.18-bioc/meat/FLAMES.Rcheck/00check.log’ for details.
FLAMES.Rcheck/00install.out
############################################################################## ############################################################################## ### ### Running command: ### ### /home/biocbuild/bbs-3.18-bioc/R/bin/R CMD INSTALL FLAMES ### ############################################################################## ############################################################################## * installing to library ‘/home/biocbuild/bbs-3.18-bioc/R/site-library’ * installing *source* package ‘FLAMES’ ... ** using non-staged installation via StagedInstall field ** libs using C++ compiler: ‘g++ (Ubuntu 11.4.0-1ubuntu1~22.04) 11.4.0’ using C++17 g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.18-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.18-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.18-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.18-bioc/R/site-library/zlibbioc/include' -I/usr/local/include -fpic -g -O2 -Wall -c RcppExports.cpp -o RcppExports.o g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.18-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.18-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.18-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.18-bioc/R/site-library/zlibbioc/include' -I/usr/local/include -fpic -g -O2 -Wall -c flexiplex.cpp -o flexiplex.o flexiplex.cpp: In function ‘unsigned int edit_distance(const string&, const string&, unsigned int&, int)’: flexiplex.cpp:118:21: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare] 118 | if (min_value <= max_editd) | ~~~~~~~~~~^~~~~~~~~~~~ flexiplex.cpp: In function ‘Barcode get_barcode(const string&, const std::unordered_set<std::__cxx11::basic_string<char> >&, int, int, const std::vector<std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > >&)’: flexiplex.cpp:224:19: warning: comparison of integer expressions of different signedness: ‘int’ and ‘__gnu_cxx::__alloc_traits<std::allocator<long unsigned int>, long unsigned int>::value_type’ {aka ‘long unsigned int’} [-Wsign-compare] 224 | if (i_pattern >= subpattern_ends[i_subpattern]) { flexiplex.cpp:285:22: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare] 285 | if (editDistance == barcode.editd) { | ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~ flexiplex.cpp:287:29: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare] 287 | } else if (editDistance < barcode.editd && | ~~~~~~~~~~~~~^~~~~~~~~~~~~~~ flexiplex.cpp:288:29: warning: comparison of integer expressions of different signedness: ‘unsigned int’ and ‘int’ [-Wsign-compare] 288 | editDistance <= barcode_max_editd) { // if best so far, update | ~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~ flexiplex.cpp: In function ‘std::vector<Barcode> big_barcode_search(const string&, const std::unordered_set<std::__cxx11::basic_string<char> >&, int, int, const std::vector<std::pair<std::__cxx11::basic_string<char>, std::__cxx11::basic_string<char> > >&)’: flexiplex.cpp:350:29: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const size_type’ {aka ‘const long unsigned int’} [-Wsign-compare] 350 | if (barcode.flank_end == std::string::npos) { | ~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~ flexiplex.cpp: In function ‘void print_stats(const string&, const std::vector<Barcode>&, std::ostream&)’: flexiplex.cpp:375:38: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const size_type’ {aka ‘const long unsigned int’} [-Wsign-compare] 375 | << (barcode.flank_end == std::string::npos ? "True" : "False") | ~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~ flexiplex.cpp: In function ‘void print_read(const string&, const string&, const string&, const std::vector<Barcode>&, std::ofstream&, std::unordered_set<std::__cxx11::basic_string<char> >&, bool)’: flexiplex.cpp:400:21: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 400 | for (int b = 0; b < vec_bc.size(); b++) { | ~~^~~~~~~~~~~~~~~ flexiplex.cpp:410:32: warning: comparison of integer expressions of different signedness: ‘const int’ and ‘const size_type’ {aka ‘const long unsigned int’} [-Wsign-compare] 410 | if (vec_bc.at(b).flank_end == std::string::npos) { | ~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~ flexiplex.cpp:415:23: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 415 | for (int f = 0; f < vec_bc.size(); f++) { | ~~^~~~~~~~~~~~~~~ flexiplex.cpp: In function ‘int flexiplex(Rcpp::String, Rcpp::String, bool, int, int, Rcpp::StringVector, Rcpp::String, Rcpp::String, Rcpp::String, int)’: flexiplex.cpp:634:23: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<std::vector<SearchResult> >::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 634 | for (int t = 0; t < sr_v.size(); | ~~^~~~~~~~~~~~~ flexiplex.cpp:639:25: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<SearchResult>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 639 | for (int r = 0; r < sr_v[t].size(); r++) { // loop over the reads | ~~^~~~~~~~~~~~~~~~ flexiplex.cpp:641:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 641 | for (int b = 0; b < sr_v[t][r].vec_bc_for.size(); b++) | ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ flexiplex.cpp:643:27: warning: comparison of integer expressions of different signedness: ‘int’ and ‘std::vector<Barcode>::size_type’ {aka ‘long unsigned int’} [-Wsign-compare] 643 | for (int b = 0; b < sr_v[t][r].vec_bc_rev.size(); b++) | ~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ g++ -std=gnu++17 -I"/home/biocbuild/bbs-3.18-bioc/R/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/home/biocbuild/bbs-3.18-bioc/R/site-library/Rcpp/include' -I'/home/biocbuild/bbs-3.18-bioc/R/site-library/Rhtslib/include' -I'/home/biocbuild/bbs-3.18-bioc/R/site-library/zlibbioc/include' -I/usr/local/include -fpic -g -O2 -Wall -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o g++ -std=gnu++17 -shared -L/home/biocbuild/bbs-3.18-bioc/R/lib -L/usr/local/lib -o FLAMES.so RcppExports.o flexiplex.o utility/edlib-1.2.7/edlib.o -pthread /home/biocbuild/bbs-3.18-bioc/R/site-library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -L/home/biocbuild/bbs-3.18-bioc/R/lib -lR if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi installing to /home/biocbuild/bbs-3.18-bioc/R/site-library/FLAMES/libs ** R ** data *** moving datasets to lazyload DB ** inst ** byte-compile and prepare package for lazy loading ** help *** installing help indices ** building package indices ** installing vignettes ** testing if installed package can be loaded * DONE (FLAMES)
FLAMES.Rcheck/tests/testthat.Rout
R version 4.3.3 (2024-02-29) -- "Angel Food Cake" Copyright (C) 2024 The R Foundation for Statistical Computing Platform: x86_64-pc-linux-gnu (64-bit) R is free software and comes with ABSOLUTELY NO WARRANTY. You are welcome to redistribute it under certain conditions. Type 'license()' or 'licence()' for distribution details. R is a collaborative project with many contributors. Type 'contributors()' for more information and 'citation()' on how to cite R or R packages in publications. Type 'demo()' for some demos, 'help()' for on-line help, or 'help.start()' for an HTML browser interface to help. Type 'q()' to quit R. > library(testthat) > library(FLAMES) > > test_check("FLAMES") Writing configuration parameters to: /tmp/RtmpAjGZlV/file2f79526db711ff/config_file_3111250.json FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmpAjGZlV/bc_allow.tsv Number of known barcodes: 143 Searching for barcodes... Number of reads processed: 393 Number of reads where a barcode was found: 368 Number of reads where more than one barcode was found: 4 All done! Skipping TSO trimming... [ FAIL 0 | WARN 0 | SKIP 0 | PASS 4 ] > > proc.time() user system elapsed 22.450 1.824 24.265
FLAMES.Rcheck/FLAMES-Ex.timings
name | user | system | elapsed | |
annotation_to_fasta | 1.175 | 0.095 | 1.272 | |
blaze | 0.448 | 0.071 | 2.155 | |
bulk_long_pipeline | 0.647 | 0.088 | 1.343 | |
combine_sce | 1.441 | 0.240 | 1.681 | |
create_config | 0.003 | 0.004 | 0.007 | |
create_sce_from_dir | 0.132 | 0.004 | 0.135 | |
create_se_from_dir | 0.709 | 0.028 | 1.249 | |
cutadapt | 0 | 0 | 0 | |
filter_annotation | 0.728 | 0.080 | 0.808 | |
find_barcode | 0.109 | 0.008 | 0.118 | |
find_isoform | 0.506 | 0.045 | 0.947 | |
get_GRangesList | 0.613 | 0.058 | 1.101 | |
locate_minimap2_dir | 0.001 | 0.001 | 0.001 | |
minimap2_align | 0.684 | 0.040 | 1.161 | |
minimap2_realign | 1.253 | 0.132 | 1.837 | |
parse_gff_tree | 0.50 | 0.02 | 0.54 | |
plot_coverage | 1.692 | 0.120 | 2.340 | |
plot_demultiplex | 0.562 | 0.100 | 0.663 | |
quantify_transcript | 2.083 | 0.263 | 2.849 | |
sc_DTU_analysis | 1.679 | 0.476 | 2.154 | |
sc_heatmap_expression | 35.113 | 2.361 | 36.174 | |
sc_long_multisample_pipeline | 1.006 | 0.028 | 1.034 | |
sc_long_pipeline | 0.112 | 0.004 | 0.117 | |
sc_mutations | 0.115 | 0.000 | 0.115 | |
sc_reduce_dims | 17.907 | 0.692 | 17.293 | |
sc_umap_expression | 29.863 | 0.729 | 29.278 | |