Back to Multiple platform build/check report for BioC 3.19: simplified long |
|
This page was generated on 2024-03-04 11:39:12 -0500 (Mon, 04 Mar 2024).
Hostname | OS | Arch (*) | R version | Installed pkgs |
---|---|---|---|---|
nebbiolo1 | Linux (Ubuntu 22.04.3 LTS) | x86_64 | R Under development (unstable) (2024-01-16 r85808) -- "Unsuffered Consequences" | 4676 |
palomino3 | Windows Server 2022 Datacenter | x64 | R Under development (unstable) (2024-01-14 r85805 ucrt) -- "Unsuffered Consequences" | 4414 |
merida1 | macOS 12.7.1 Monterey | x86_64 | R Under development (unstable) (2024-01-16 r85808) -- "Unsuffered Consequences" | 4441 |
kunpeng2 | Linux (openEuler 22.03 LTS-SP1) | aarch64 | R Under development (unstable) (2024-01-16 r85812) -- "Unsuffered Consequences" | 4417 |
Click on any hostname to see more info about the system (e.g. compilers) (*) as reported by 'uname -p', except on Windows and Mac OS X |
Package 716/2251 | Hostname | OS / Arch | INSTALL | BUILD | CHECK | BUILD BIN | ||||||||
FLAMES 1.9.0 (landing page) Changqing Wang
| nebbiolo1 | Linux (Ubuntu 22.04.3 LTS) / x86_64 | OK | OK | OK | |||||||||
palomino3 | Windows Server 2022 Datacenter / x64 | ... NOT SUPPORTED ... | ||||||||||||
merida1 | macOS 12.7.1 Monterey / x86_64 | OK | OK | OK | OK | |||||||||
kunpeng2 | Linux (openEuler 22.03 LTS-SP1) / aarch64 | OK | OK | ERROR | ||||||||||
To the developers/maintainers of the FLAMES package: - Allow up to 24 hours (and sometimes 48 hours) for your latest push to git@git.bioconductor.org:packages/FLAMES.git to reflect on this report. See Troubleshooting Build Report for more information. - Use the following Renviron settings to reproduce errors and warnings. - If 'R CMD check' started to fail recently on the Linux builder(s) over a missing dependency, add the missing dependency to 'Suggests:' in your DESCRIPTION file. See Renviron.bioc for more information. |
Package: FLAMES |
Version: 1.9.0 |
Command: /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_1.9.0.tar.gz |
StartedAt: 2024-03-02 04:04:44 -0500 (Sat, 02 Mar 2024) |
EndedAt: 2024-03-02 04:24:39 -0500 (Sat, 02 Mar 2024) |
EllapsedTime: 1194.9 seconds |
RetCode: 0 |
Status: OK |
CheckDir: FLAMES.Rcheck |
Warnings: 0 |
############################################################################## ############################################################################## ### ### Running command: ### ### /Library/Frameworks/R.framework/Resources/bin/R CMD check --install=check:FLAMES.install-out.txt --library=/Library/Frameworks/R.framework/Resources/library --no-vignettes --timings FLAMES_1.9.0.tar.gz ### ############################################################################## ############################################################################## * using log directory ‘/Users/biocbuild/bbs-3.19-bioc/meat/FLAMES.Rcheck’ * using R Under development (unstable) (2024-01-16 r85808) * using platform: x86_64-apple-darwin20 * R was compiled by Apple clang version 14.0.0 (clang-1400.0.29.202) GNU Fortran (GCC) 12.2.0 * running under: macOS Monterey 12.7.1 * using session charset: UTF-8 * using option ‘--no-vignettes’ * checking for file ‘FLAMES/DESCRIPTION’ ... OK * checking extension type ... Package * this is package ‘FLAMES’ version ‘1.9.0’ * package encoding: UTF-8 * checking package namespace information ... OK * checking package dependencies ... OK * checking if this is a source package ... OK * checking if there is a namespace ... OK * checking for hidden files and directories ... NOTE Found the following hidden files and directories: .BBSoptions These were most likely included in error. See section ‘Package structure’ in the ‘Writing R Extensions’ manual. * checking for portable file names ... OK * checking for sufficient/correct file permissions ... OK * checking whether package ‘FLAMES’ can be installed ... NOTE Found the following notes/warnings: Non-staged installation was used See ‘/Users/biocbuild/bbs-3.19-bioc/meat/FLAMES.Rcheck/00install.out’ for details. * used C++ compiler: ‘Apple clang version 14.0.0 (clang-1400.0.29.202)’ * used SDK: ‘MacOSX11.3.sdk’ * checking C++ specification ... OK Not all R platforms support C++17 * checking installed package size ... OK * checking package directory ... OK * checking ‘build’ directory ... OK * checking DESCRIPTION meta-information ... OK * checking top-level files ... OK * checking for left-over files ... OK * checking index information ... OK * checking package subdirectories ... OK * checking R files for non-ASCII characters ... OK * checking R files for syntax errors ... OK * checking whether the package can be loaded ... OK * checking whether the package can be loaded with stated dependencies ... OK * checking whether the package can be unloaded cleanly ... OK * checking whether the namespace can be loaded with stated dependencies ... OK * checking whether the namespace can be unloaded cleanly ... OK * checking dependencies in R code ... OK * checking S3 generic/method consistency ... OK * checking replacement functions ... OK * checking foreign function calls ... OK * checking R code for possible problems ... NOTE annotation_to_fasta: no visible global function definition for 'write.table' find_variants: no visible binding for global variable 'nucleotide' find_variants: no visible binding for global variable 'ref' find_variants : <anonymous>: no visible binding for global variable 'pos' find_variants : <anonymous>: no visible binding for global variable 'count' find_variants: no visible binding for global variable 'count' generate_sc_sce: no visible binding for global variable 'FSM_match' homopolymer_pct : <anonymous>: no visible binding for global variable 'Freq' homopolymer_pct : <anonymous>: no visible binding for global variable 'pct' plot_coverage: no visible binding for global variable 'x' plot_coverage: no visible binding for global variable 'transcript' plot_coverage: no visible binding for global variable 'length_bin' plot_demultiplex: no visible binding for global variable 'Freq' plot_demultiplex: no visible binding for global variable '.' plot_demultiplex: no visible binding for global variable 'x' plot_demultiplex: no visible binding for global variable 'FlankEditDist' plot_demultiplex: no visible binding for global variable 'n' plot_demultiplex: no visible binding for global variable 'BarcodeEditDist' plot_flagstat: no visible global function definition for 'everything' plot_flagstat: no visible binding for global variable 'name' plot_flagstat: no visible binding for global variable 'value' sc_DTU_analysis: no visible binding for global variable 'FSM_match' sc_DTU_analysis: no visible binding for global variable 'gene_id' sc_DTU_analysis: no visible binding for global variable '.' sc_DTU_analysis: no visible binding for global variable 'cell_id' sc_DTU_analysis: no visible binding for global variable 'cnt' sc_DTU_analysis: no visible binding for global variable 'tr_id' sc_DTU_analysis: no visible binding for global variable 'label' sc_DTU_analysis : filter_tr: no visible binding for global variable 'gene_id' sc_DTU_analysis : filter_tr: no visible global function definition for 'all_vars' sc_DTU_analysis : filter_tr: no visible binding for global variable '.' sc_DTU_analysis: no visible global function definition for 'all_vars' sc_heatmap_expression: no visible binding for global variable 'transcript_id' sc_heatmap_expression: no visible binding for global variable 'gene_id' sc_heatmap_expression : group_annotation: no visible binding for global variable 'heatmap_annotation_colors' sc_umap_expression: no visible binding for global variable 'transcript_id' sc_umap_expression: no visible binding for global variable 'gene_id' sc_umap_expression: no visible binding for global variable 'x' sc_umap_expression: no visible binding for global variable 'y' sc_umap_expression : plot_idx: no visible binding for global variable 'x' sc_umap_expression : plot_idx: no visible binding for global variable 'y' transcript_coverage: no visible binding for global variable 'mat' Undefined global functions or variables: . BarcodeEditDist FSM_match FlankEditDist Freq all_vars cell_id cnt count everything gene_id heatmap_annotation_colors label length_bin mat n name nucleotide pct pos ref tr_id transcript transcript_id value write.table x y Consider adding importFrom("utils", "write.table") to your NAMESPACE file. * checking Rd files ... OK * checking Rd metadata ... OK * checking Rd cross-references ... OK * checking for missing documentation entries ... OK * checking for code/documentation mismatches ... OK * checking Rd \usage sections ... OK * checking Rd contents ... OK * checking for unstated dependencies in examples ... OK * checking contents of ‘data’ directory ... OK * checking data for non-ASCII characters ... OK * checking LazyData ... OK * checking data for ASCII and uncompressed saves ... OK * checking line endings in shell scripts ... OK * checking line endings in C/C++/Fortran sources/headers ... OK * checking line endings in Makefiles ... OK * checking compilation flags in Makevars ... OK * checking for GNU extensions in Makefiles ... NOTE GNU make is a SystemRequirements. * checking for portable use of $(BLAS_LIBS) and $(LAPACK_LIBS) ... OK * checking use of PKG_*FLAGS in Makefiles ... OK * checking compiled code ... NOTE Note: information on .o files is not available * checking files in ‘vignettes’ ... OK * checking examples ... OK Examples with CPU (user + system) or elapsed time > 5s user system elapsed sc_heatmap_expression 65.126 1.331 78.680 sc_umap_expression 57.270 0.784 66.327 sc_reduce_dims 27.692 0.476 31.519 quantify_transcript 4.115 0.165 5.176 combine_sce 3.742 0.448 5.081 * checking for unstated dependencies in ‘tests’ ... OK * checking tests ... Running ‘testthat.R’ OK * checking for unstated dependencies in vignettes ... OK * checking package vignettes ... OK * checking running R code from vignettes ... SKIPPED * checking re-building of vignette outputs ... SKIPPED * checking PDF version of manual ... OK * DONE Status: 5 NOTEs See ‘/Users/biocbuild/bbs-3.19-bioc/meat/FLAMES.Rcheck/00check.log’ for details.
FLAMES.Rcheck/00install.out
############################################################################## ############################################################################## ### ### Running command: ### ### /Library/Frameworks/R.framework/Resources/bin/R CMD INSTALL FLAMES ### ############################################################################## ############################################################################## * installing to library ‘/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library’ * installing *source* package ‘FLAMES’ ... ** using non-staged installation via StagedInstall field ** libs using C++ compiler: ‘Apple clang version 14.0.0 (clang-1400.0.29.202)’ using C++17 using SDK: ‘MacOSX11.3.sdk’ clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/zlibbioc/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c RcppExports.cpp -o RcppExports.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/zlibbioc/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c flexiplex.cpp -o flexiplex.o clang++ -arch x86_64 -std=gnu++17 -I"/Library/Frameworks/R.framework/Resources/include" -DNDEBUG -pthread -D_FILE_OFFSET_BITS=64 -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rcpp/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rhtslib/include' -I'/Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/zlibbioc/include' -I/opt/R/x86_64/include -fPIC -falign-functions=64 -Wall -g -O2 -c utility/edlib-1.2.7/edlib.cpp -o utility/edlib-1.2.7/edlib.o clang++ -arch x86_64 -std=gnu++17 -dynamiclib -Wl,-headerpad_max_install_names -undefined dynamic_lookup -L/Library/Frameworks/R.framework/Resources/lib -L/opt/R/x86_64/lib -o FLAMES.so RcppExports.o flexiplex.o utility/edlib-1.2.7/edlib.o -pthread /Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/Rhtslib/usrlib/libhts.a -lcurl -lbz2 -llzma -lz -F/Library/Frameworks/R.framework/.. -framework R -Wl,-framework -Wl,CoreFoundation if test -e "/usr/bin/strip" & test -e "/bin/uname" & [[ `uname` == "Linux" ]] ; then /usr/bin/strip --strip-debug FLAMES.so; fi installing to /Library/Frameworks/R.framework/Versions/4.4-x86_64/Resources/library/FLAMES/libs ** R ** data *** moving datasets to lazyload DB ** inst ** byte-compile and prepare package for lazy loading ** help *** installing help indices ** building package indices ** installing vignettes ** testing if installed package can be loaded * DONE (FLAMES)
FLAMES.Rcheck/tests/testthat.Rout
R Under development (unstable) (2024-01-16 r85808) -- "Unsuffered Consequences" Copyright (C) 2024 The R Foundation for Statistical Computing Platform: x86_64-apple-darwin20 R is free software and comes with ABSOLUTELY NO WARRANTY. You are welcome to redistribute it under certain conditions. Type 'license()' or 'licence()' for distribution details. R is a collaborative project with many contributors. Type 'contributors()' for more information and 'citation()' on how to cite R or R packages in publications. Type 'demo()' for some demos, 'help()' for on-line help, or 'help.start()' for an HTML browser interface to help. Type 'q()' to quit R. > library(testthat) > library(FLAMES) > > test_check("FLAMES") Writing configuration parameters to: /tmp/RtmprqV0sW/file14f9932a99560/config_file_85913.json FLEXIPLEX 0.96.2 Setting max barcode edit distance to 2 Setting max flanking sequence edit distance to 8 Setting read IDs to be replaced Setting number of threads to 1 Search pattern: primer: CTACACGACGCTCTTCCGATCT BC: NNNNNNNNNNNNNNNN UMI: NNNNNNNNNNNN polyT: TTTTTTTTT Setting known barcodes from /tmp/RtmprqV0sW/bc_allow.tsv Number of known barcodes: 143 Searching for barcodes... Number of reads processed: 393 Number of reads where a barcode was found: 368 Number of reads where more than one barcode was found: 4 All done! Skipping TSO trimming... [ FAIL 0 | WARN 0 | SKIP 0 | PASS 4 ] > > proc.time() user system elapsed 40.665 2.543 49.099
FLAMES.Rcheck/FLAMES-Ex.timings
name | user | system | elapsed | |
annotation_to_fasta | 2.808 | 0.114 | 3.469 | |
blaze | 0.528 | 0.108 | 2.057 | |
bulk_long_pipeline | 1.174 | 0.224 | 2.165 | |
combine_sce | 3.742 | 0.448 | 5.081 | |
create_config | 0.016 | 0.004 | 0.027 | |
create_sce_from_dir | 0.295 | 0.028 | 0.438 | |
create_se_from_dir | 1.135 | 0.212 | 1.727 | |
cutadapt | 0.000 | 0.001 | 0.001 | |
filter_annotation | 1.623 | 0.029 | 2.026 | |
find_barcode | 0.221 | 0.023 | 0.281 | |
find_isoform | 0.841 | 0.128 | 1.205 | |
get_GRangesList | 1.044 | 0.123 | 1.450 | |
locate_minimap2_dir | 0.004 | 0.005 | 0.014 | |
minimap2_align | 1.603 | 0.137 | 2.127 | |
minimap2_realign | 1.938 | 0.136 | 2.530 | |
parse_gff_tree | 0.773 | 0.038 | 0.975 | |
plot_coverage | 2.288 | 0.135 | 2.862 | |
plot_demultiplex | 1.122 | 0.069 | 1.347 | |
quantify_transcript | 4.115 | 0.165 | 5.176 | |
sc_DTU_analysis | 1.926 | 0.040 | 2.356 | |
sc_heatmap_expression | 65.126 | 1.331 | 78.680 | |
sc_long_multisample_pipeline | 2.462 | 0.148 | 3.166 | |
sc_long_pipeline | 0.286 | 0.027 | 0.392 | |
sc_mutations | 0.289 | 0.021 | 0.417 | |
sc_reduce_dims | 27.692 | 0.476 | 31.519 | |
sc_umap_expression | 57.270 | 0.784 | 66.327 | |