##############################################################################
##############################################################################
###
### Running command:
###
###   /home/biocbuild/R/R-4.3.1/bin/R CMD check --install=check:Biostrings.install-out.txt --library=/home/biocbuild/R/R-4.3.1/site-library --no-vignettes --timings Biostrings_2.70.1.tar.gz
###
##############################################################################
##############################################################################


* using log directory ‘/home/biocbuild/bbs-3.18-bioc/meat/Biostrings.Rcheck’
* using R version 4.3.1 (2023-06-16)
* using platform: aarch64-unknown-linux-gnu (64-bit)
* R was compiled by
    gcc (GCC) 10.3.1
    GNU Fortran (GCC) 10.3.1
* running under: openEuler 22.03 (LTS-SP1)
* using session charset: UTF-8
* using option ‘--no-vignettes’
* checking for file ‘Biostrings/DESCRIPTION’ ... OK
* this is package ‘Biostrings’ version ‘2.70.1’
* package encoding: UTF-8
* checking package namespace information ... OK
* checking package dependencies ... OK
* checking if this is a source package ... OK
* checking if there is a namespace ... OK
* checking for hidden files and directories ... OK
* checking for portable file names ... OK
* checking for sufficient/correct file permissions ... OK
* checking whether package ‘Biostrings’ can be installed ... OK
* used C compiler: ‘gcc (GCC) 10.3.1’
* checking installed package size ... NOTE
  installed size is 14.8Mb
  sub-directories of 1Mb or more:
    R         1.7Mb
    extdata  11.1Mb
    libs      1.1Mb
* checking package directory ... OK
* checking ‘build’ directory ... OK
* checking DESCRIPTION meta-information ... NOTE
Package listed in more than one of Depends, Imports, Suggests, Enhances:
  ‘methods’
A package should be listed in only one of these fields.
* checking top-level files ... OK
* checking for left-over files ... OK
* checking index information ... OK
* checking package subdirectories ... OK
* checking R files for non-ASCII characters ... OK
* checking R files for syntax errors ... OK
* checking whether the package can be loaded ... OK
* checking whether the package can be loaded with stated dependencies ... OK
* checking whether the package can be unloaded cleanly ... OK
* checking whether the namespace can be loaded with stated dependencies ... OK
* checking whether the namespace can be unloaded cleanly ... OK
* checking loading without being on the library search path ... OK
* checking startup messages can be suppressed ... OK
* checking dependencies in R code ... OK
* checking S3 generic/method consistency ... OK
* checking replacement functions ... OK
* checking foreign function calls ... OK
* checking R code for possible problems ... OK
* checking Rd files ... OK
* checking Rd metadata ... OK
* checking Rd cross-references ... OK
* checking for missing documentation entries ... WARNING
Undocumented code objects:
  ‘strsplit’ ‘twoWayAlphabetFrequency’
Undocumented S4 methods:
  generic 'hasOnlyBaseLetters' and siglist 'AAString'
  generic 'hasOnlyBaseLetters' and siglist 'AAStringSet'
  generic 'match' and siglist 'Vector,XStringSet'
  generic 'match' and siglist 'XStringSet,Vector'
  generic 'match' and siglist 'XStringSet,vector'
  generic 'match' and siglist 'vector,XStringSet'
  generic 'parallel_slot_names' and siglist 'ByPos_MIndex'
  generic 'parallel_slot_names' and siglist 'MIndex'
  generic 'pcompare' and siglist 'Vector,XStringSet'
  generic 'pcompare' and siglist 'XStringSet,Vector'
  generic 'pcompare' and siglist 'XStringSet,vector'
  generic 'pcompare' and siglist 'vector,XStringSet'
  generic 'relistToClass' and siglist 'XString'
  generic 'strsplit' and siglist 'XStringSet'
  generic 'twoWayAlphabetFrequency' and siglist 'XString,XString'
  generic 'twoWayAlphabetFrequency' and siglist 'XString,XStringSet'
  generic 'twoWayAlphabetFrequency' and siglist 'XStringSet,XString'
  generic 'twoWayAlphabetFrequency' and siglist 'XStringSet,XStringSet'
  generic 'unstrsplit' and siglist 'XStringSet'
  generic 'unstrsplit' and siglist 'XStringSetList'
  generic 'updateObject' and siglist 'AAString'
  generic 'updateObject' and siglist 'AAStringSet'
All user-level objects in a package (including S4 classes and methods)
should have documentation entries.
See chapter ‘Writing R documentation files’ in the ‘Writing R
Extensions’ manual.
* checking for code/documentation mismatches ... OK
* checking Rd \usage sections ... OK
* checking Rd contents ... OK
* checking for unstated dependencies in examples ... OK
* checking contents of ‘data’ directory ... OK
* checking data for non-ASCII characters ... OK
* checking data for ASCII and uncompressed saves ... OK
* checking line endings in C/C++/Fortran sources/headers ... OK
* checking compiled code ... NOTE
Note: information on .o files is not available
* checking files in ‘vignettes’ ... OK
* checking examples ... ERROR
Running examples in ‘Biostrings-Ex.R’ failed
The error most likely occurred in:

> base::assign(".ptime", proc.time(), pos = "CheckExEnv")
> ### Name: findPalindromes
> ### Title: Searching a sequence for palindromes
> ### Aliases: findPalindromes findPalindromes,XString-method
> ###   findPalindromes,DNAString-method findPalindromes,RNAString-method
> ###   findPalindromes,XStringViews-method
> ###   findPalindromes,MaskedXString-method palindromeArmLength
> ###   palindromeArmLength,XString-method
> ###   palindromeArmLength,DNAString-method
> ###   palindromeArmLength,RNAString-method
> ###   palindromeArmLength,XStringViews-method
> ###   palindromeArmLength,XStringSet-method palindromeLeftArm
> ###   palindromeRightArm palindromeLeftArm,XString-method
> ###   palindromeRightArm,XString-method
> ###   palindromeLeftArm,XStringViews-method
> ###   palindromeRightArm,XStringViews-method
> ### Keywords: methods
> 
> ### ** Examples
> 
> x0 <- BString("abbbaabbcbbaccacabbbccbcaabbabacca")
> 
> pals0a <- findPalindromes(x0, min.armlength=3, max.looplength=5)
> pals0a
Views on a 34-letter BString subject
subject: abbbaabbcbbaccacabbbccbcaabbabacca
views:
      start end width
  [1]     3   8     6 [bbaabb]
  [2]     6  12     7 [abbcbba]
  [3]    10  19    10 [bbaccacabb]
> palindromeArmLength(pals0a)
[1] 3 3 4
> palindromeLeftArm(pals0a)
Views on a 34-letter BString subject
subject: abbbaabbcbbaccacabbbccbcaabbabacca
views:
      start end width
  [1]     3   5     3 [bba]
  [2]     6   8     3 [abb]
  [3]    10  13     4 [bbac]
> palindromeRightArm(pals0a)
Views on a 34-letter BString subject
subject: abbbaabbcbbaccacabbbccbcaabbabacca
views:
      start end width
  [1]     6   8     3 [abb]
  [2]    10  12     3 [bba]
  [3]    16  19     4 [cabb]
> 
> pals0b <- findPalindromes(x0, min.armlength=9, max.looplength=5,
+                           max.mismatch=3)
> pals0b
Views on a 34-letter BString subject
subject: abbbaabbcbbaccacabbbccbcaabbabacca
views:
      start end width
  [1]     1  29    29 [abbbaabbcbbaccacabbbccbcaabba]
  [2]    10  28    19 [bbaccacabbbccbcaabb]
  [3]     8  30    23 [bcbbaccacabbbccbcaabbab]
  [4]    12  34    23 [accacabbbccbcaabbabacca]
> palindromeArmLength(pals0b, max.mismatch=3)
[1] 11  9  9 11
> palindromeLeftArm(pals0b, max.mismatch=3)
Views on a 34-letter BString subject
subject: abbbaabbcbbaccacabbbccbcaabbabacca
views:
      start end width
  [1]     1  11    11 [abbbaabbcbb]
  [2]    10  18     9 [bbaccacab]
  [3]     8  16     9 [bcbbaccac]
  [4]    12  22    11 [accacabbbcc]
> palindromeRightArm(pals0b, max.mismatch=3)
Views on a 34-letter BString subject
subject: abbbaabbcbbaccacabbbccbcaabbabacca
views:
      start end width
  [1]    19  29    11 [bbccbcaabba]
  [2]    20  28     9 [bccbcaabb]
  [3]    22  30     9 [cbcaabbab]
  [4]    24  34    11 [caabbabacca]
> 
> ## Whitespaces matter:
> x1 <- BString("Delia saw I was aileD")
> palindromeArmLength(x1)
[1] 10
> palindromeLeftArm(x1)
10-letter BString object
seq: Delia saw 
> palindromeRightArm(x1)
10-letter BString object
seq:  was aileD
> 
> x2 <- BString("was it a car or a cat I saw")
> palindromeArmLength(x2)
[1] 4
> palindromeLeftArm(x2)
4-letter BString object
seq: was 
> palindromeRightArm(x2)
4-letter BString object
seq:  saw
> 
> ## On a DNA or RNA sequence:
> x3 <- DNAString("CCGAAAACCATGATGGTTGCCAG")
> findPalindromes(x3)
Views on a 23-letter DNAString subject
subject: CCGAAAACCATGATGGTTGCCAG
views:
      start end width
  [1]     6  18    13 [AACCATGATGGTT]
> findPalindromes(RNAString(x3))
Views on a 23-letter RNAString subject
subject: CCGAAAACCAUGAUGGUUGCCAG
views:
      start end width
  [1]     6  18    13 [AACCAUGAUGGUU]
> 
> ## Note that palindromes can be nested:
> x4 <- DNAString("ACGTTNAACGTCCAAAATTTTCCACGTTNAACGT")
> findPalindromes(x4, max.looplength=19)
Views on a 34-letter DNAString subject
subject: ACGTTNAACGTCCAAAATTTTCCACGTTNAACGT
views:
      start end width
  [1]     1  11    11 [ACGTTNAACGT]
  [2]     1  27    27 [ACGTTNAACGTCCAAAATTTTCCACGT]
  [3]    14  21     8 [AAAATTTT]
  [4]     7  28    22 [AACGTCCAAAATTTTCCACGTT]
  [5]     8  34    27 [ACGTCCAAAATTTTCCACGTTNAACGT]
  [6]    24  34    11 [ACGTTNAACGT]
> 
> ## Treat wobble base pairings as matches:
> x5 <- RNAString("AUGUCUNNNNAGGCGU")
> findPalindromes(x5, max.looplength=4, min.looplength=4)
Views on a 16-letter RNAString subject
subject: AUGUCUNNNNAGGCGU
views: NONE
> findPalindromes(x5, max.looplength=4, min.looplength=4, max.mismatch=2)
Views on a 16-letter RNAString subject
subject: AUGUCUNNNNAGGCGU
views:
      start end width
  [1]     1  16    16 [AUGUCUNNNNAGGCGU]
> findPalindromes(x5, max.looplength=4, min.looplength=4, allow.wobble=TRUE)
Views on a 16-letter RNAString subject
subject: AUGUCUNNNNAGGCGU
views:
      start end width
  [1]     1  16    16 [AUGUCUNNNNAGGCGU]
> 
> ## A real use case:
> library(BSgenome.Dmelanogaster.UCSC.dm3)
Loading required package: BSgenome
Loading required package: GenomicRanges
Loading required package: BiocIO
Loading required package: rtracklayer

Attaching package: ‘rtracklayer’

The following object is masked from ‘package:BiocIO’:

    FileForFormat

> chrX <- Dmelanogaster$chrX
> chrX_pals0 <- findPalindromes(chrX, min.armlength=40, max.looplength=80)
* checking for unstated dependencies in ‘tests’ ... OK
* checking tests ...
  Running ‘run_unitTests.R’
 OK
* checking for unstated dependencies in vignettes ... OK
* checking package vignettes in ‘inst/doc’ ... OK
* checking running R code from vignettes ... SKIPPED
* checking re-building of vignette outputs ... SKIPPED
* checking PDF version of manual ... OK
* DONE

Status: 1 ERROR, 1 WARNING, 3 NOTEs
See
  ‘/home/biocbuild/bbs-3.18-bioc/meat/Biostrings.Rcheck/00check.log’
for details.